ID: 985632068

View in Genome Browser
Species Human (GRCh38)
Location 5:1018926-1018948
Sequence ATCCCTGCTTTGGGGCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 169}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985632062_985632068 0 Left 985632062 5:1018903-1018925 CCTCCGAAAGGGCAGAGAGCACC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 985632068 5:1018926-1018948 ATCCCTGCTTTGGGGCATCTAGG 0: 1
1: 0
2: 1
3: 6
4: 169
985632063_985632068 -3 Left 985632063 5:1018906-1018928 CCGAAAGGGCAGAGAGCACCATC 0: 1
1: 0
2: 0
3: 11
4: 167
Right 985632068 5:1018926-1018948 ATCCCTGCTTTGGGGCATCTAGG 0: 1
1: 0
2: 1
3: 6
4: 169
985632061_985632068 6 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632068 5:1018926-1018948 ATCCCTGCTTTGGGGCATCTAGG 0: 1
1: 0
2: 1
3: 6
4: 169
985632058_985632068 22 Left 985632058 5:1018881-1018903 CCACAGGGAGGAACATCCTTGGC 0: 1
1: 0
2: 1
3: 21
4: 202
Right 985632068 5:1018926-1018948 ATCCCTGCTTTGGGGCATCTAGG 0: 1
1: 0
2: 1
3: 6
4: 169
985632056_985632068 23 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG No data
Right 985632068 5:1018926-1018948 ATCCCTGCTTTGGGGCATCTAGG 0: 1
1: 0
2: 1
3: 6
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985632068 Original CRISPR ATCCCTGCTTTGGGGCATCT AGG Intronic