ID: 985632071

View in Genome Browser
Species Human (GRCh38)
Location 5:1018928-1018950
Sequence CCCTGCTTTGGGGCATCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985632061_985632071 8 Left 985632061 5:1018897-1018919 CCTTGGCCTCCGAAAGGGCAGAG No data
Right 985632071 5:1018928-1018950 CCCTGCTTTGGGGCATCTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 120
985632058_985632071 24 Left 985632058 5:1018881-1018903 CCACAGGGAGGAACATCCTTGGC 0: 1
1: 0
2: 1
3: 21
4: 202
Right 985632071 5:1018928-1018950 CCCTGCTTTGGGGCATCTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 120
985632062_985632071 2 Left 985632062 5:1018903-1018925 CCTCCGAAAGGGCAGAGAGCACC 0: 1
1: 0
2: 1
3: 8
4: 130
Right 985632071 5:1018928-1018950 CCCTGCTTTGGGGCATCTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 120
985632056_985632071 25 Left 985632056 5:1018880-1018902 CCCACAGGGAGGAACATCCTTGG No data
Right 985632071 5:1018928-1018950 CCCTGCTTTGGGGCATCTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 120
985632063_985632071 -1 Left 985632063 5:1018906-1018928 CCGAAAGGGCAGAGAGCACCATC 0: 1
1: 0
2: 0
3: 11
4: 167
Right 985632071 5:1018928-1018950 CCCTGCTTTGGGGCATCTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985632071 Original CRISPR CCCTGCTTTGGGGCATCTAG GGG Intronic