ID: 985634126

View in Genome Browser
Species Human (GRCh38)
Location 5:1027690-1027712
Sequence GACACCCGTGTGTTTCCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 62}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985634125_985634126 -7 Left 985634125 5:1027674-1027696 CCGTGACTTCACTGTGGACACCC 0: 1
1: 0
2: 1
3: 18
4: 161
Right 985634126 5:1027690-1027712 GACACCCGTGTGTTTCCCACCGG 0: 1
1: 0
2: 0
3: 7
4: 62
985634123_985634126 1 Left 985634123 5:1027666-1027688 CCAGAGGGCCGTGACTTCACTGT 0: 1
1: 0
2: 0
3: 21
4: 92
Right 985634126 5:1027690-1027712 GACACCCGTGTGTTTCCCACCGG 0: 1
1: 0
2: 0
3: 7
4: 62
985634117_985634126 27 Left 985634117 5:1027640-1027662 CCCTAGACCAGGGTTTAGGTCAT 0: 1
1: 0
2: 1
3: 3
4: 94
Right 985634126 5:1027690-1027712 GACACCCGTGTGTTTCCCACCGG 0: 1
1: 0
2: 0
3: 7
4: 62
985634118_985634126 26 Left 985634118 5:1027641-1027663 CCTAGACCAGGGTTTAGGTCATG 0: 1
1: 0
2: 1
3: 6
4: 102
Right 985634126 5:1027690-1027712 GACACCCGTGTGTTTCCCACCGG 0: 1
1: 0
2: 0
3: 7
4: 62
985634119_985634126 20 Left 985634119 5:1027647-1027669 CCAGGGTTTAGGTCATGTCCCAG 0: 1
1: 0
2: 1
3: 10
4: 116
Right 985634126 5:1027690-1027712 GACACCCGTGTGTTTCCCACCGG 0: 1
1: 0
2: 0
3: 7
4: 62
985634122_985634126 2 Left 985634122 5:1027665-1027687 CCCAGAGGGCCGTGACTTCACTG 0: 1
1: 0
2: 2
3: 14
4: 108
Right 985634126 5:1027690-1027712 GACACCCGTGTGTTTCCCACCGG 0: 1
1: 0
2: 0
3: 7
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985634126 Original CRISPR GACACCCGTGTGTTTCCCAC CGG Intronic
905220014 1:36439047-36439069 GACACCTGTGTGGTCCCCTCAGG - Intronic
912978235 1:114348671-114348693 GACACCCGAACGTTTCCCTCAGG - Intergenic
915583201 1:156828592-156828614 CACACGCCTGTGTTTGCCACAGG + Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1065268177 10:23999248-23999270 GAAACCTGTGTGTTTGCCCCAGG + Intronic
1065442275 10:25764836-25764858 GACAGCCTTGGGTTTCCCAAAGG + Intergenic
1067174193 10:43930964-43930986 GACATCCCTGAGTGTCCCACAGG + Intergenic
1070177108 10:73980199-73980221 GAGACCCCACTGTTTCCCACTGG - Intergenic
1073642535 10:105267685-105267707 GACGCCCTTGCTTTTCCCACTGG + Intergenic
1074777415 10:116776194-116776216 GACACCTGCCTGTGTCCCACAGG - Intergenic
1085591438 11:77765715-77765737 GACAGCCGTATGTGTCCCTCTGG - Intronic
1086607502 11:88713695-88713717 GAAACACATGTATTTCCCACTGG - Intronic
1086793264 11:91067899-91067921 GACACCCGTCTGTGGCCCAGGGG - Intergenic
1090277978 11:125432759-125432781 GTCACACGTGTGTTTTCCATTGG + Exonic
1091251647 11:134148876-134148898 GAGACCCGTGTGGTTTCCAAGGG - Intronic
1091650203 12:2303849-2303871 AAAACCTGTGTGTTTCCCACAGG + Intronic
1102908215 12:116693761-116693783 GACCCCCGTGCGACTCCCACTGG - Intergenic
1103012077 12:117465440-117465462 GAAACCCCTGTGTTTCCCAAAGG - Exonic
1105905413 13:24804964-24804986 GACAACAGTGTCTTTCTCACAGG - Intronic
1108267974 13:48731151-48731173 GAGACCTGTGTGTCTCCCACAGG - Intergenic
1114408116 14:22475215-22475237 GGCACCCCTCTGTTCCCCACAGG - Intergenic
1115311688 14:31984827-31984849 GCCACCAGTGTGTTTCCCAAGGG + Intergenic
1115340058 14:32283945-32283967 GACACCTGTGTGTTTAGCATGGG - Intergenic
1115537584 14:34387652-34387674 GACACCTGTTTGTTAACCACTGG + Intronic
1123937910 15:25202895-25202917 GACACGTGAGTGTTTCCCATGGG + Intergenic
1132238191 15:100237563-100237585 GACAGCAGTGTCTTCCCCACGGG - Intronic
1140438292 16:74966633-74966655 GACACCCGTGACTTTCCAAAGGG + Intronic
1141673127 16:85503244-85503266 GACACCCGTGTGGTGACCCCTGG - Intergenic
1143619099 17:8070990-8071012 GACAAACATGAGTTTCCCACTGG - Intergenic
1158445145 18:57513476-57513498 TACACCTGTTTCTTTCCCACTGG + Intergenic
1167983632 19:53297293-53297315 TACACCCGCGCATTTCCCACAGG + Intergenic
928389809 2:30900572-30900594 GTCACCGCTGTCTTTCCCACCGG - Intergenic
948758126 2:240171105-240171127 GACCTCTGTGTGTTTTCCACGGG + Intergenic
1170732477 20:18986956-18986978 GAGAGCAGTGTTTTTCCCACTGG + Intergenic
1171366875 20:24631030-24631052 GACACCCTTGGATTGCCCACAGG + Intronic
1174081187 20:47971846-47971868 GGCACCCGTGGGGTTCCCCCAGG + Intergenic
1177938743 21:27382625-27382647 GTCAACCATCTGTTTCCCACTGG + Intergenic
1178081672 21:29073026-29073048 GAAAGCCGTATGTTTCTCACTGG + Intronic
1184096952 22:42321290-42321312 GCCACCCTTGTGTTCCCCAGAGG - Intronic
961035712 3:123640239-123640261 GACACCAGTGTGTATTGCACTGG - Intronic
974199895 4:58623770-58623792 GAGGCCAGTGTGTTTCCCAAGGG + Intergenic
976586559 4:86803766-86803788 GGCACCCGTGTATTTACCAGAGG - Exonic
985634126 5:1027690-1027712 GACACCCGTGTGTTTCCCACCGG + Intronic
985669258 5:1198061-1198083 GACACACCTGAGTTTCCCAGGGG - Intergenic
993056917 5:82991718-82991740 GAGGCCCCTGTGTTTCCCATTGG - Intergenic
997416387 5:133732040-133732062 GCAACCTGTGTGCTTCCCACCGG + Intergenic
997786495 5:136718412-136718434 GACACCTCAGTGCTTCCCACTGG + Intergenic
998646516 5:144067894-144067916 GAGAGCCGTGAGATTCCCACAGG - Intergenic
998766061 5:145488405-145488427 CACTCCCGTGTTTTTCCCACCGG + Intronic
1002417500 5:179128090-179128112 GAGACCCGGGTGTCTCCCACCGG + Exonic
1017526676 6:155247243-155247265 TAAACCAGTGTTTTTCCCACTGG - Intronic
1018266440 6:162029436-162029458 CACATCCTTGTATTTCCCACAGG + Intronic
1018729365 6:166637252-166637274 GACACACGAGTGCTTCCTACAGG + Intronic
1019879575 7:3846761-3846783 GACAGCCGTGTCTTTACCCCTGG + Intronic
1023687304 7:42749689-42749711 GTCACCCGTCACTTTCCCACTGG + Intergenic
1030234378 7:107242677-107242699 GAAACCAGTCTGTCTCCCACAGG + Intronic
1032221480 7:129997768-129997790 CATTCCCGTGTGTTTCCCCCAGG - Intergenic
1034989714 7:155540702-155540724 GCAAGCCGTGTGTTACCCACAGG - Intergenic
1036031801 8:4981949-4981971 GACAACCGTGTGTGGCCCCCAGG + Intronic
1043268305 8:78295693-78295715 GAATGCAGTGTGTTTCCCACAGG + Intergenic
1048494314 8:134922495-134922517 GAATCCCATGTGGTTCCCACAGG - Intergenic
1049312319 8:141939613-141939635 GACACCTGTGTATTAGCCACAGG + Intergenic
1053921875 9:43002623-43002645 GAGACCAGTCTGTCTCCCACGGG - Intergenic
1055553331 9:77451115-77451137 GACACACGTATGTTCCCCATAGG - Intronic
1058705217 9:107632158-107632180 GAGACCCGTGTGTGTCCCCCAGG - Intergenic
1061370017 9:130192837-130192859 AACACCTGTGGGGTTCCCACTGG - Intronic
1062026398 9:134342651-134342673 GAGGCCCCTGTGGTTCCCACAGG + Intronic
1187194660 X:17071656-17071678 GAAACGCTTGTGTCTCCCACTGG - Intronic
1195208113 X:102624633-102624655 GAGACCAGTCTGTCTCCCACAGG - Intergenic
1199121413 X:144058754-144058776 TACACATGTGTGTTTCTCACTGG + Intergenic