ID: 985634192

View in Genome Browser
Species Human (GRCh38)
Location 5:1027945-1027967
Sequence CCGACAGACGGGGTGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985634180_985634192 13 Left 985634180 5:1027909-1027931 CCTGTGTTGCAGCTGCCTGGCGC 0: 1
1: 0
2: 3
3: 15
4: 117
Right 985634192 5:1027945-1027967 CCGACAGACGGGGTGGCTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 60
985634185_985634192 -9 Left 985634185 5:1027931-1027953 CCTCTGCAGGGGTTCCGACAGAC 0: 1
1: 0
2: 1
3: 1
4: 69
Right 985634192 5:1027945-1027967 CCGACAGACGGGGTGGCTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 60
985634177_985634192 27 Left 985634177 5:1027895-1027917 CCACCAGGATGATACCTGTGTTG No data
Right 985634192 5:1027945-1027967 CCGACAGACGGGGTGGCTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 60
985634184_985634192 -2 Left 985634184 5:1027924-1027946 CCTGGCGCCTCTGCAGGGGTTCC 0: 1
1: 0
2: 2
3: 26
4: 203
Right 985634192 5:1027945-1027967 CCGACAGACGGGGTGGCTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 60
985634178_985634192 24 Left 985634178 5:1027898-1027920 CCAGGATGATACCTGTGTTGCAG 0: 1
1: 0
2: 2
3: 13
4: 157
Right 985634192 5:1027945-1027967 CCGACAGACGGGGTGGCTCTGGG 0: 1
1: 0
2: 0
3: 2
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985634192 Original CRISPR CCGACAGACGGGGTGGCTCT GGG Intronic