ID: 985636311

View in Genome Browser
Species Human (GRCh38)
Location 5:1037554-1037576
Sequence CAGGACACACAGTGGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 446}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985636302_985636311 20 Left 985636302 5:1037511-1037533 CCCAAGCAGGGTCTCAGCTGTGC 0: 1
1: 0
2: 1
3: 26
4: 422
Right 985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG 0: 1
1: 0
2: 5
3: 41
4: 446
985636301_985636311 21 Left 985636301 5:1037510-1037532 CCCCAAGCAGGGTCTCAGCTGTG 0: 1
1: 0
2: 1
3: 24
4: 210
Right 985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG 0: 1
1: 0
2: 5
3: 41
4: 446
985636303_985636311 19 Left 985636303 5:1037512-1037534 CCAAGCAGGGTCTCAGCTGTGCG 0: 1
1: 0
2: 1
3: 6
4: 175
Right 985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG 0: 1
1: 0
2: 5
3: 41
4: 446
985636300_985636311 29 Left 985636300 5:1037502-1037524 CCACGGCGCCCCAAGCAGGGTCT 0: 1
1: 0
2: 2
3: 9
4: 129
Right 985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG 0: 1
1: 0
2: 5
3: 41
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985636311 Original CRISPR CAGGACACACAGTGGGGACA AGG Intronic
900161251 1:1225029-1225051 AGGGACACAGACTGGGGACACGG + Intronic
900404192 1:2485360-2485382 CCGGAGCCCCAGTGGGGACAGGG + Intronic
900711782 1:4119091-4119113 CAGGACACCGGGTGGGGGCATGG - Intergenic
901220498 1:7580867-7580889 GAGGTCACACAGTCAGGACAGGG - Intronic
902332625 1:15738079-15738101 CAGGACAGTCTGTGGGGAGAGGG - Exonic
902368061 1:15990211-15990233 CAGGACACAGAGGGTGGCCACGG - Intergenic
902912876 1:19613658-19613680 CCTGGCACACAGTGGGTACACGG + Intronic
902962927 1:19977475-19977497 GATGACTCACTGTGGGGACAGGG - Intronic
903051727 1:20606142-20606164 CAGGACACACCTCGGTGACAGGG - Intronic
903051894 1:20607349-20607371 CAGGACACACCTCGGTGACAGGG - Intronic
903063797 1:20687254-20687276 CAGCAGACACAGTGGAGCCACGG + Intronic
903740840 1:25557495-25557517 CCAGACACACACTGGGGACATGG - Intronic
904434226 1:30483854-30483876 GAGGCCACACAGTGGGGACTGGG + Intergenic
904651638 1:32010344-32010366 AATGATACACAGTGAGGACAAGG + Intergenic
906315767 1:44785552-44785574 CAGGACATACAGTAGGCACTGGG + Intronic
906647697 1:47487743-47487765 CAGGACACACAGTCAAGAAAGGG - Intergenic
906824873 1:48968664-48968686 AAGGCCACACAGTGGGTCCATGG + Intronic
907257964 1:53194428-53194450 GTGGACACACAGTGGAAACAAGG + Intergenic
907421098 1:54348011-54348033 CAGTGCACACAGTGAGGAAAGGG - Intronic
907515508 1:54991029-54991051 TGGGACACACAGTGGGGAGTGGG - Intronic
909959165 1:81817726-81817748 CACAACACAGAATGGGGACAAGG - Intronic
910908317 1:92206471-92206493 AAGAACACACAATGGGGAAAAGG - Intergenic
911016146 1:93334956-93334978 CAACACACACAGAGGGGAAATGG - Intergenic
911817317 1:102369263-102369285 CAGGAGACGGAGTGGGAACAGGG - Intergenic
912761215 1:112369271-112369293 CAGGTCACATAGTGGGGTGAGGG - Intergenic
913137423 1:115906183-115906205 CAGGACCCAAAGGTGGGACATGG + Intergenic
913147443 1:116006289-116006311 TAGGAGATACAGTGGGGACCAGG - Intronic
913321881 1:117594383-117594405 GAGGACCCACACTGAGGACAAGG - Intergenic
915573114 1:156756510-156756532 CAGGTCACACAGTTGGCAAATGG - Intronic
915700570 1:157790390-157790412 AAGAACACACAATGGGGAAAGGG + Intergenic
915706061 1:157844921-157844943 CAGAAAACACAATGTGGACAAGG - Intronic
916030685 1:160875251-160875273 CAGGATAGAGAATGGGGACAAGG + Intergenic
916468694 1:165099700-165099722 AAGCACACACATTGGGGAAAGGG + Intergenic
916544584 1:165791378-165791400 CAGGAAATACAGAGGGTACAGGG + Intronic
917278919 1:173360735-173360757 CAGGACTCACTGTGCGGGCAAGG + Intergenic
917826568 1:178827846-178827868 AAGAACACACAATGGGGAAATGG + Intronic
918045399 1:180938178-180938200 CAAGGGACACAGTGGGAACAGGG - Intronic
918423622 1:184387250-184387272 CCGGACACACTGTGGGGAGGAGG + Exonic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
920943818 1:210509687-210509709 CAGCACACACAGAGTGGAGAAGG - Intronic
921601491 1:217111129-217111151 CAGGTCAGACACTGGGGACCAGG + Intronic
922702415 1:227769637-227769659 CAGGACAGGCAGGGGTGACACGG + Intronic
922777524 1:228222840-228222862 AAGGTCACACAGTGGGTAAACGG + Intronic
1062846943 10:714933-714955 CAGTCCACACAGTGAGCACAGGG + Intergenic
1065983199 10:30923305-30923327 CAGGAAAAACAGTGAGGTCATGG - Intronic
1067221776 10:44349036-44349058 CAGGACTCACAGTGCGGGCAGGG + Intergenic
1068714126 10:60168709-60168731 AAGGACACACACTGGGGCCTGGG - Intronic
1069163607 10:65120564-65120586 AAAGATACACAGTGGGGAAAAGG - Intergenic
1072615003 10:97043360-97043382 CCGGACTCACAGTGTGGAGAGGG + Exonic
1073026264 10:100489287-100489309 CATGACTCACACTGGAGACAGGG + Exonic
1073061591 10:100736714-100736736 CAGGTTTCCCAGTGGGGACAAGG - Intronic
1073423195 10:103440650-103440672 CAGGGCACCCAGTGGGGCCGAGG + Intronic
1073440003 10:103546927-103546949 CAGGACACAGAGGTGGGAAATGG - Intronic
1073805891 10:107097421-107097443 TATGACACACAGTGTGGACATGG - Intronic
1073890069 10:108091025-108091047 CAGTACTCACAGTGGGCACGGGG + Intergenic
1074449726 10:113549361-113549383 GAGGTCACACAGTGGGGAGGTGG + Intergenic
1075200767 10:120402052-120402074 CAGTATACAGAGTGAGGACAGGG - Intergenic
1075224069 10:120609695-120609717 CATCACACACAGTGCAGACATGG - Intergenic
1076908125 10:133373313-133373335 CAGGACACGCAGGGCGGCCATGG + Exonic
1076946690 10:133656483-133656505 CCTAACACACAGTGGGGGCAGGG - Intergenic
1077132271 11:979007-979029 CAGGAGACACCATGGGGAGAAGG + Intronic
1077549469 11:3193643-3193665 CCCGACACTCAGAGGGGACAGGG + Intergenic
1077650415 11:3966491-3966513 CAGGACAGAAAGTAAGGACAGGG - Intronic
1077817912 11:5705918-5705940 CAGCATACACAGTGAGTACATGG + Intronic
1078668426 11:13344704-13344726 CAGGACTTGCAGTGGGGACAGGG + Intronic
1080038784 11:27737131-27737153 GAGGACAGACAGTGGGGATAAGG - Intergenic
1080690078 11:34549130-34549152 CAGGGCACACAGTTTGGGCAGGG - Intergenic
1081744412 11:45462953-45462975 CAGGACAAGCTGTGGGCACATGG - Intergenic
1083310245 11:61780230-61780252 CAGCACGTACAGTGTGGACATGG - Exonic
1084033419 11:66494011-66494033 CAGGACAGACACTTGGGGCAGGG + Intronic
1084604094 11:70162439-70162461 GAGTCCACAAAGTGGGGACAAGG + Intronic
1084605797 11:70170929-70170951 CAGCGCAAACAGTGGGGCCAGGG - Exonic
1084658681 11:70534561-70534583 CAGGACACAGGGCTGGGACAAGG + Intronic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1085842146 11:80024555-80024577 CAGGACAGAGAGTAGGGTCAGGG + Intergenic
1086063537 11:82723972-82723994 CAGCACACATAAAGGGGACAGGG + Intergenic
1087370462 11:97277503-97277525 CAGGAAAAACAGTGGGTACTAGG + Intergenic
1087479850 11:98685526-98685548 AAGGACATACACTGGGGAAAAGG - Intergenic
1089309780 11:117550414-117550436 CAGGCCAGACACTGGGGCCAGGG - Intronic
1089582008 11:119487206-119487228 CAGGACCCACAGTGAGGATGGGG - Intergenic
1091172657 11:133532185-133532207 CAGGAGAGGCAGTGGGGAGATGG - Intronic
1091853785 12:3722634-3722656 CAGGACACACAGTACCAACAGGG + Intronic
1092044850 12:5424019-5424041 CAGGACACTCACTTGGCACATGG - Intergenic
1092665143 12:10788059-10788081 AAGAACACACAATGGGGAAAAGG - Intergenic
1094163052 12:27412109-27412131 AAGAACACTCAGTGGGGAAAAGG - Intronic
1096257512 12:50072414-50072436 CAGAACACACAGAGGGGCCAGGG + Intronic
1097415047 12:59304728-59304750 TTGGACAGACAGTGGGGACAGGG - Intergenic
1097695595 12:62772361-62772383 CAGGACACAGAATGGGGCAATGG - Intronic
1101052620 12:100879089-100879111 ATGGACCCACAGTGGGGAAAAGG + Intronic
1101445304 12:104733111-104733133 GAGGACACACCCTGGAGACAAGG - Intronic
1102678385 12:114673743-114673765 AAGGTCACACAGCGGGTACATGG - Intronic
1102956203 12:117060695-117060717 CAGCTCACCCAGTGGGGGCATGG + Intronic
1103342024 12:120225855-120225877 CAGGACAGGCAGCTGGGACAAGG - Intronic
1103407198 12:120684684-120684706 AAGGCCACACAGTGGGTAAATGG + Intergenic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103806472 12:123577546-123577568 CAGGACAAACAGCTGGCACATGG - Intergenic
1103898517 12:124290875-124290897 CAGATCACACAGCCGGGACATGG + Intronic
1104092761 12:125529522-125529544 CAGGACACACAGAGGTGGGAAGG - Intronic
1104155370 12:126126170-126126192 CAGGAACCACAGTGGGGATGAGG + Intergenic
1104625201 12:130347344-130347366 AAGGACCCACCGTGGGGAGAAGG - Intronic
1107348773 13:39491643-39491665 AAGGACATGGAGTGGGGACAAGG + Intronic
1107428615 13:40318378-40318400 CAGGACACAAAGTGAAGGCAGGG - Intergenic
1107549229 13:41458841-41458863 GAGGGGGCACAGTGGGGACATGG + Intronic
1108509808 13:51146630-51146652 AAGGACTCACAGTGGGGAGGGGG + Intergenic
1109308440 13:60664463-60664485 CAGGATATACAGTGGGGCCATGG + Intergenic
1111833680 13:93360898-93360920 CTGGCCACACAGTGGGGTCACGG - Intronic
1114261827 14:21042565-21042587 GAGGACACGCATTGGGGAAAGGG + Intronic
1114650891 14:24284047-24284069 CAGGACACACTGAGGGGGCAAGG + Intergenic
1117232290 14:53732835-53732857 AAGAACACACAATGGGGAAAGGG + Intergenic
1117293648 14:54358424-54358446 AAGAACACACAATGGGGAAAGGG - Intergenic
1118745050 14:68767493-68767515 CAGGCTCCACAGTAGGGACAGGG - Intergenic
1119535274 14:75397793-75397815 CAGTTCAGACAGAGGGGACAAGG + Intergenic
1120878206 14:89393849-89393871 CAGGAAACTGGGTGGGGACAAGG + Intronic
1121218297 14:92265308-92265330 CAGGCCAGGTAGTGGGGACAGGG + Intergenic
1121472778 14:94168173-94168195 CAGGCCACACAGTGACAACAGGG - Intronic
1122142664 14:99672179-99672201 CAGGCCACACAGTAGGTGCATGG + Intronic
1122675838 14:103412565-103412587 CAGGACCCACACTTGGGACAGGG + Intronic
1122805262 14:104253282-104253304 CAGGGCACACAGTGGCCCCAGGG - Intergenic
1122828077 14:104381814-104381836 CACAGTACACAGTGGGGACAAGG + Intergenic
1122913522 14:104845224-104845246 CAGGACACAGATTGGGGGAAAGG + Intergenic
1122942815 14:104990024-104990046 CACCACACACAGAGGGCACACGG - Intronic
1202848649 14_GL000225v1_random:1858-1880 CAGGACACGGGGTTGGGACAGGG + Intergenic
1202920773 14_KI270723v1_random:29037-29059 CCTAACACACAGTGGGGGCAGGG - Intergenic
1202924143 14_KI270724v1_random:8544-8566 CCTAACACACAGTGGGGGCAGGG + Intergenic
1123476052 15:20593129-20593151 CCAGACACAGTGTGGGGACAGGG + Intergenic
1123641960 15:22407235-22407257 CCAGACACAGTGTGGGGACAGGG - Intergenic
1124375417 15:29126225-29126247 CTGGCCACACTCTGGGGACATGG + Intronic
1124895833 15:33776637-33776659 CAGAAAGCACAGTGGGGACAGGG - Intronic
1125074306 15:35595237-35595259 CAGGAAACACAATGAGGACAAGG + Intergenic
1125974348 15:43937881-43937903 CAGGACCCCTAGTGGGGACCTGG + Intronic
1127814402 15:62594540-62594562 AAGAACACACAATGGGGAAAGGG + Intronic
1128213498 15:65918086-65918108 CAGCACACACTGTGGGCACAGGG + Exonic
1129322801 15:74783936-74783958 CAGGCTACAGACTGGGGACATGG + Intronic
1130027939 15:80285991-80286013 GAGGACAGACAGAGGGGTCAGGG - Intergenic
1130619973 15:85452762-85452784 CAGGACACTGAGAGGGAACATGG - Intronic
1131051204 15:89349288-89349310 CTGGCCTCAGAGTGGGGACAGGG + Intergenic
1132204663 15:99978098-99978120 CAGGACCAAGAGTGAGGACACGG - Intronic
1132208406 15:100002487-100002509 CAGGACACACTGGGGGGACGAGG + Intronic
1132543110 16:520610-520632 CAGGCCACACCGTGCAGACACGG - Intronic
1132735444 16:1383783-1383805 CTGGACACACTCTGGGGACTTGG - Intronic
1132867763 16:2102380-2102402 CAGGAAACACAAAGCGGACATGG + Exonic
1133231077 16:4366913-4366935 CTGGCAACACAGTGGGGACGGGG - Intronic
1133295229 16:4748713-4748735 CAGGACACATCCTGGAGACAAGG - Exonic
1134023564 16:10938426-10938448 CATGTCACACAGTGGGGCCCAGG - Intronic
1134815004 16:17198481-17198503 GAAGACACAGAGAGGGGACAGGG - Intronic
1135109544 16:19680118-19680140 AAGGTCACACAGTTGGTACATGG - Intronic
1136057287 16:27699742-27699764 CAGGGCACACAGTGAGGACCTGG - Intronic
1136075407 16:27813774-27813796 CAGGAAACACGGAGGGGACAAGG + Intronic
1136991421 16:35153392-35153414 CTGGAAGCACAGTGGGGTCAAGG + Intergenic
1137407577 16:48201998-48202020 AAGGTCACACAGTGGTGACCTGG - Intronic
1137650416 16:50114991-50115013 CAAGAAACACAGTGGGCAGAGGG - Intergenic
1138084738 16:54123124-54123146 AAGGCCACAATGTGGGGACAGGG + Intergenic
1138458089 16:57132762-57132784 CAGGTCACACAGTGGGGCCTGGG - Intronic
1138490848 16:57375655-57375677 CAGGACACACAGCTGGGCAATGG + Intronic
1138988898 16:62366275-62366297 AAGAATACACAGTGGGGAAAGGG - Intergenic
1139332525 16:66204555-66204577 AAGGTGACACAGTAGGGACACGG + Intergenic
1139956473 16:70695613-70695635 CTGCACACCCAGTGGGGACCTGG - Exonic
1140815160 16:78614491-78614513 CAGGACACACACCGTGAACAGGG - Intronic
1140832234 16:78762580-78762602 CAGTACTAACAGTGGGCACAGGG + Intronic
1141657081 16:85422114-85422136 CCGGGCACACCCTGGGGACATGG - Intergenic
1142891681 17:2948024-2948046 CAGGACACACGGAGGGGACAAGG - Intronic
1143205167 17:5136150-5136172 CAGGACACAGAGGGTGGCCATGG - Intronic
1143296508 17:5875455-5875477 CAGTACACGCAATGGGCACATGG - Intronic
1143730562 17:8880513-8880535 CAGGACCCACAGTGGGACTATGG + Exonic
1143848120 17:9788523-9788545 CTGCAGACACAGTGGGTACAAGG + Intronic
1143869960 17:9951045-9951067 CTGGACACACCTTGGGGACTCGG - Intronic
1144732385 17:17536257-17536279 AAGGACACACAGTGAGTAAATGG + Intronic
1144876218 17:18398842-18398864 CAGGACACAGAGGGTGGCCACGG - Intergenic
1145156010 17:20545578-20545600 CAGGACACAGAGGGTGGCCACGG + Intergenic
1145206823 17:20988945-20988967 GAAACCACACAGTGGGGACAGGG + Intergenic
1146530749 17:33605884-33605906 CCCGAGACTCAGTGGGGACAGGG - Intronic
1146573510 17:33972795-33972817 CATAACACACTGTGGGGACTTGG + Intronic
1146843475 17:36169646-36169668 CAGGACACAGAGGGTGGCCACGG + Intronic
1146855783 17:36257584-36257606 CAGGACACAGAGGGTGGCCACGG + Intronic
1146864837 17:36330791-36330813 CAGGACACAGAGGGTGGCCACGG - Intronic
1146871690 17:36381495-36381517 CAGGACACAGAGGGTGGCCACGG + Intronic
1146879049 17:36432577-36432599 CAGGACACAGAGGGTGGCCACGG + Intronic
1146882989 17:36453723-36453745 CAGGACACAGAGGGTGGCCACGG + Intergenic
1146966770 17:37037905-37037927 CAAGAGAGAGAGTGGGGACAGGG - Intronic
1147067696 17:37931385-37931407 CAGGACACAGAGGGTGGCCACGG - Intronic
1147074576 17:37982119-37982141 CAGGACACAGAGGGTGGCCACGG + Intronic
1147079227 17:38010940-38010962 CAGGACACAGAGGGTGGCCACGG - Intronic
1147086099 17:38061658-38061680 CAGGACACAGAGGGTGGCCACGG + Intronic
1147095166 17:38134882-38134904 CAGGACACAGAGGGTGGCCACGG - Intergenic
1147102044 17:38185623-38185645 CAGGACACAGAGGGTGGCCACGG + Intergenic
1147597357 17:41725531-41725553 AAGGACACACAGTCAGGAAAGGG + Intronic
1147721083 17:42539716-42539738 AAGGATACAATGTGGGGACAAGG + Intronic
1148735797 17:49864258-49864280 CAGGGCAGAGAGTGGGGTCAGGG + Intergenic
1148821685 17:50363686-50363708 CAGGACACAGAGTGGGGGCGGGG + Intergenic
1148860415 17:50601608-50601630 CAGGGGCCATAGTGGGGACATGG + Intronic
1149846636 17:60012134-60012156 CAGGACACAGAGGGTGGCCACGG + Intergenic
1150084982 17:62268708-62268730 CAGGACACAGAGGGTGGCCACGG + Intergenic
1150227627 17:63532397-63532419 CTGGGCACACAGCGGGGAGAGGG + Intronic
1150294970 17:64002571-64002593 GAGGAGACACTGTGGGCACAGGG + Intronic
1150852269 17:68714971-68714993 CAGTAGTCACAGGGGGGACACGG - Intergenic
1152209832 17:78997196-78997218 CCTGTCAGACAGTGGGGACAAGG - Exonic
1152298269 17:79480910-79480932 CTGGAGACGCAGTGGAGACAAGG - Intronic
1152772957 17:82181335-82181357 CAGGGCACGCAGTGGGGTCTGGG + Intronic
1153378850 18:4412827-4412849 CAGGACAGAGTGTGGGGACCTGG - Intronic
1154086046 18:11306604-11306626 GAAGACACACAATGGGAACAAGG + Intergenic
1155075817 18:22353706-22353728 AAGAACACACATTGGGGAAAGGG - Intergenic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1155449332 18:25946981-25947003 CAGGACACACATTGGGTGCTGGG + Intergenic
1155545906 18:26914648-26914670 TAGGAGACACAGATGGGACACGG + Exonic
1156621115 18:38853132-38853154 GAGGAGAAACATTGGGGACAGGG - Intergenic
1158319418 18:56246990-56247012 CAGGACACACAGTGGGGTGTGGG - Intergenic
1158500680 18:57997935-57997957 GAGGAAAAACAGTGAGGACAGGG + Intergenic
1160242039 18:77131790-77131812 CAGGACAGGCAGTGGGGCCCAGG + Intronic
1160440890 18:78891549-78891571 CAGGACAGACAGATGTGACATGG - Intergenic
1160441902 18:78899478-78899500 CACGATGCACTGTGGGGACAAGG + Intergenic
1160533599 18:79579223-79579245 CAGGCCACACAGTGAGCGCACGG - Intergenic
1160662616 19:308213-308235 CAGGACACTCAGGAAGGACAGGG - Intronic
1162938678 19:13995165-13995187 CAGGCCACACAGCGGGGAAGTGG + Intronic
1164102136 19:22065711-22065733 CAGGACAAACACAGGTGACATGG + Intronic
1164725050 19:30460660-30460682 CTGCACACACAGTGGCCACATGG - Intronic
1165452084 19:35889653-35889675 CAGGTCACACTGTGAGGTCAGGG + Intronic
1165484671 19:36088525-36088547 CAAGGCACACAGAGAGGACAGGG - Intronic
1166119494 19:40677186-40677208 CAGAGCACAGAGTGGGCACAGGG - Intronic
1166523928 19:43499283-43499305 CAAGACAAACAGTGTGGAGAAGG + Intronic
1167889609 19:52528741-52528763 GGTGACACAGAGTGGGGACAGGG + Intronic
1167915031 19:52733937-52733959 GGAGACACAGAGTGGGGACAAGG - Intronic
1167941167 19:52946714-52946736 CTGGACACTAAGCGGGGACAGGG - Intronic
1168113798 19:54209589-54209611 CTGGACACACAGCAGGGAGATGG + Intronic
925396300 2:3535939-3535961 TAGGACACACAGCGGGGTCCAGG + Intronic
925907315 2:8547236-8547258 CATCACAGACACTGGGGACACGG - Intergenic
926006006 2:9373928-9373950 CAGCACACACAGTGGGTCCCGGG - Intronic
926284889 2:11481494-11481516 CAGGACCCACAGTGGGGCCTTGG - Intergenic
927647288 2:24886153-24886175 CTGGGAACACAGTGGGGACTGGG - Intronic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
928253798 2:29704747-29704769 CAGGAGCCACAGTGAGAACAGGG + Intronic
928262899 2:29783773-29783795 CAGGGAACCCAGTGAGGACAGGG - Intronic
929549537 2:42880601-42880623 TAGGAAACAATGTGGGGACAGGG - Intergenic
932269216 2:70394504-70394526 ATGGACACATGGTGGGGACAGGG - Intergenic
932841312 2:75085349-75085371 CAGGACACCAAGTGAGGAGATGG - Intronic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
933236019 2:79865586-79865608 CAGAACACACAGTGCAGGCAGGG + Intronic
934834225 2:97568378-97568400 CAGGATACAGAGTAGGGTCAAGG + Intronic
934957393 2:98634166-98634188 CAGGACATACAGGAGAGACACGG + Intronic
934992353 2:98930474-98930496 CAGGACAGAGGGTGGGGACGGGG - Intronic
935106823 2:100052564-100052586 CTGCACATAGAGTGGGGACAAGG - Intronic
936087500 2:109479255-109479277 CAGCACACAGGGTGGGGACACGG + Intronic
936402188 2:112173789-112173811 CAGGACACAGAGTGGGTGCCGGG + Intronic
936795679 2:116201146-116201168 CTGGACACTCAGTGTGGACAAGG - Intergenic
937127127 2:119482051-119482073 CAGGCCACACAGCCAGGACATGG + Intronic
937517694 2:122673979-122674001 CACGAAGCACAGTGGGGACTGGG - Intergenic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
937871028 2:126786400-126786422 GAGGAAACACAGTGGTGAAAGGG + Intergenic
938499398 2:131822548-131822570 GAGGACACACAGGGTGGCCAGGG + Intergenic
940771552 2:157844348-157844370 GAGCAAACCCAGTGGGGACAGGG - Intronic
941036472 2:160574403-160574425 CAAGACAAACAGTGGACACATGG - Intergenic
943726922 2:191261485-191261507 ACGGACACACAGTGTGAACATGG - Intronic
944347084 2:198682148-198682170 CACTACACACAGTGGGGAAAGGG + Intergenic
945126064 2:206511437-206511459 GAGGAGAGCCAGTGGGGACAGGG + Intronic
945958204 2:216105887-216105909 GAAGACAGAGAGTGGGGACAGGG + Intergenic
946365374 2:219245703-219245725 CAGGACACACAGCGGCTACCGGG - Intronic
946823149 2:223650225-223650247 CAGGAGGCATAATGGGGACACGG - Intergenic
947178426 2:227390960-227390982 CAGGACACACAATGGTGTGATGG + Intergenic
948588720 2:239036457-239036479 CAGGCACCACAGTGGGGACAGGG + Intergenic
948741320 2:240048398-240048420 CAGGAGAGACAGTGCGGAGATGG - Intergenic
948771419 2:240253050-240253072 CCGGACACAAAGTGGGCAGAGGG + Intergenic
948792910 2:240388474-240388496 CAGACCACCCAGCGGGGACATGG + Intergenic
1169225130 20:3851615-3851637 CAGGACACACAGTGAGTTCAAGG + Intronic
1170157219 20:13279762-13279784 CAGGGCAAACAGCGGGGACCAGG + Exonic
1170160938 20:13310307-13310329 AAGAACACACAATGGGGAAAGGG + Intergenic
1170163966 20:13343590-13343612 CAGGAACCACAGTGGGGGCGGGG - Intergenic
1170699806 20:18693761-18693783 CTGGATACACAATGGGGATAAGG - Intronic
1171971450 20:31567440-31567462 GAGGGCAAACAGTGGGGGCAGGG - Intronic
1172106078 20:32518045-32518067 AGGGACACACAGTGGGGAACAGG + Intronic
1172194857 20:33084864-33084886 CGGGACACAGAGTGGTGAGAAGG - Intronic
1173173899 20:40749776-40749798 AAGGCCACACAGTGAGGGCAAGG + Intergenic
1173201830 20:40960351-40960373 GTGCACACAGAGTGGGGACAAGG + Intergenic
1173404400 20:42752412-42752434 AAGGTCACAGAGTTGGGACAAGG + Intronic
1173718125 20:45229457-45229479 CTGGATACACAGTGGGAAGAGGG + Intergenic
1173841023 20:46157414-46157436 AAGGTCACACAGTGAGAACAAGG + Intergenic
1174314588 20:49688363-49688385 CAGGACACACCATGGGGGAAGGG + Intronic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1174594803 20:51675419-51675441 CAGGCTACACAGTGAGGACGGGG - Intronic
1174797536 20:53534789-53534811 CAGATCACACAATGGGGATATGG - Intergenic
1175291367 20:57877887-57877909 CAGGACGCACAGTGGTGAAAGGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1175877502 20:62237268-62237290 CAGGACGCACTGCGGGGTCACGG + Intronic
1175893733 20:62326974-62326996 CAGGACAGACAGAGGTGACCTGG + Intronic
1176147762 20:63573046-63573068 CAGGGCACACAGCCGGGCCAGGG + Intronic
1179122028 21:38556713-38556735 GAGGACACAGAGTGGGGGGAAGG + Intronic
1179421730 21:41241764-41241786 TAGGACTCACAGTGTAGACATGG - Intronic
1179473124 21:41625521-41625543 CTGCACACAGAGTGGGGACAGGG + Intergenic
1180067494 21:45419915-45419937 CGGGCCACAGAGCGGGGACACGG - Intronic
1181052023 22:20242377-20242399 CAGGGCACGCAGGGGGGCCAGGG + Exonic
1181324161 22:22032157-22032179 CAGGAAGCCCAATGGGGACAGGG - Intergenic
1181415474 22:22755776-22755798 CAGGACCCAGGGTGGGGACAAGG + Intronic
1181849161 22:25737453-25737475 CAGAAGACACAGTTGGGTCAGGG + Intergenic
1182146174 22:27998168-27998190 CAGGCCACACAGCCAGGACATGG + Intronic
1182779381 22:32855502-32855524 AAGGCCACACAGTTGGGAAATGG - Intronic
1183020055 22:35019554-35019576 CAGGTCACACAGCAGGGCCAGGG + Intergenic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1183177129 22:36232594-36232616 CAGGTCACACAGAAGGGACTTGG + Intronic
1183180711 22:36257946-36257968 CAGGTCACACAGAGGGGATGTGG - Intronic
1183283863 22:36950639-36950661 CTGGGCACACAGTGGGGACAGGG + Intergenic
1183356889 22:37364447-37364469 GAGGGCACTCAGAGGGGACAGGG + Intergenic
1183680998 22:39329133-39329155 AAGGATACACAGTAGTGACAGGG - Intergenic
1184090480 22:42290545-42290567 CAGGCCACACTGTGGGGAGAGGG - Intronic
1184281742 22:43441345-43441367 CAGGTGACACAGTGGGCAGAGGG - Intronic
1184644329 22:45888085-45888107 CAGGAGTCCCCGTGGGGACAGGG + Intergenic
1184728071 22:46357763-46357785 GGGGACACCCAGTGGGGAGATGG - Intergenic
1184995717 22:48205953-48205975 GAGGGGACACACTGGGGACAAGG + Intergenic
1185001724 22:48250411-48250433 CAGGGCACTCACTGGGGCCAGGG - Intergenic
1185148589 22:49152027-49152049 ACGGGCACACAGCGGGGACACGG + Intergenic
950139043 3:10602394-10602416 CAGGCCACACAGTCAGGACATGG + Intronic
950435247 3:12975415-12975437 CAGGGCACACAGTCTGGACCAGG + Intronic
950638563 3:14333227-14333249 GAGGCCACACAGTGAGCACATGG - Intergenic
953239745 3:41138126-41138148 AAGGACACACAGTTGGGGAATGG + Intergenic
953891473 3:46754706-46754728 CAGGACTCAGAGTGGGCACTGGG - Intronic
953996512 3:47523915-47523937 CAGGACTTGCAGTGGGGACGGGG + Intergenic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
954632641 3:52055682-52055704 CAAACCACACAGTGGGGACCCGG + Intronic
954671771 3:52294832-52294854 CCACACACACACTGGGGACATGG - Intergenic
954901291 3:54022204-54022226 CAGGATAGACAGAGGGAACAGGG + Intergenic
954935504 3:54323107-54323129 CATGGCTCACAGTGAGGACAAGG - Intronic
954962536 3:54578991-54579013 AAGGCCACACAGTGAGTACACGG + Intronic
955028021 3:55189194-55189216 CAGGAGAAACACTGGAGACAAGG + Intergenic
955859342 3:63310944-63310966 CAGGACACACTGAGAGTACAGGG - Intronic
955957529 3:64305657-64305679 CAGGTCCCACAGTAGGAACAGGG - Intronic
956934785 3:74088333-74088355 GAGGACAGACAGTGGGGAAGTGG - Intergenic
957080766 3:75633927-75633949 CCTAACACACAGTGGGGGCAGGG + Intergenic
958747062 3:98149367-98149389 GAGGACATGCAGTGAGGACATGG + Exonic
958748700 3:98168681-98168703 GAGGACATGCAGTGAGGACATGG + Exonic
958751521 3:98197192-98197214 GAGGACATGCAGTGAGGACATGG + Intronic
958752393 3:98207404-98207426 GAGGACATGCAGTGAGGACATGG + Intergenic
958754807 3:98238333-98238355 GAGGACATGCAGTGAGGACATGG + Intergenic
958832638 3:99108194-99108216 AAGGAGACACAGGGGGAACAAGG - Intergenic
961381360 3:126498323-126498345 TGGGACACAGAGAGGGGACAGGG - Intronic
961656931 3:128447982-128448004 CACTACACACAGTGTGGGCAGGG + Intergenic
963355004 3:144200253-144200275 CAGGATCCTCAGTGGGGAGAAGG + Intergenic
964623013 3:158734049-158734071 CCGGACACTCAGTGAGGCCAAGG + Intronic
965787650 3:172352876-172352898 CAGGACACAGAGAGTGGAGACGG - Exonic
966233804 3:177678349-177678371 CAGGAGATACAGTGGTGAAAAGG - Intergenic
966862812 3:184239874-184239896 CTGGAGACACTGTGGGGACCTGG + Exonic
967321819 3:188201944-188201966 CAGGTCAAGCAGAGGGGACAAGG + Intronic
967865588 3:194187420-194187442 CATGACACACAGGGGTCACATGG - Intergenic
969116650 4:4874446-4874468 CAGCAGTCACACTGGGGACAGGG - Intergenic
969391249 4:6892648-6892670 AAGGCCACACAGTGGGAACCAGG - Intergenic
969709674 4:8835551-8835573 CAGGACACAGTGTGAGGTCACGG - Intergenic
970436508 4:16040746-16040768 CCTGGCACACAGTGGGCACATGG + Intronic
973834230 4:54793049-54793071 GAGGCCACACAGTAGGTACATGG + Intergenic
973911312 4:55583676-55583698 AAGAACACACAATGGGGAAAAGG - Intronic
973949905 4:56001515-56001537 AAGAACATACAATGGGGACAGGG - Intronic
974780974 4:66552129-66552151 AAGAACACACACTGGGGAAAAGG + Intergenic
974901896 4:68009736-68009758 CAGGACATGGAGTGGGGAGAAGG - Intergenic
975953244 4:79800997-79801019 AAGGAGACACAATGGTGACAAGG + Intergenic
977105411 4:92876758-92876780 CAGAACACACAGGGAGGACAGGG + Intronic
980694519 4:136337723-136337745 GGTGACAAACAGTGGGGACAAGG - Intergenic
981562525 4:146063438-146063460 CAGGGGACTCAGTGGGGAGATGG + Intergenic
981753571 4:148117667-148117689 GAGGGGACACAGTGGTGACATGG - Intronic
983316519 4:166139456-166139478 CTGGAAGCAGAGTGGGGACATGG - Intergenic
983876686 4:172884879-172884901 AAGAACATACAGTGGGGAAAAGG - Intronic
984397407 4:179219470-179219492 CAGGTCACACAGTGAATACAAGG - Intergenic
984401627 4:179272775-179272797 CAGGAAACACAGTGGGGGAAAGG - Intergenic
985071800 4:186172937-186172959 CAAGAGAAACAGTGGGGAGAGGG - Intergenic
985450146 4:190057282-190057304 CCTAACACACAGTGGGGGCAGGG - Intergenic
985636311 5:1037554-1037576 CAGGACACACAGTGGGGACAAGG + Intronic
985754160 5:1703335-1703357 CAGGAGAGAAAGTGGGGCCAGGG - Intergenic
986417853 5:7546471-7546493 CAGGGCACACAGTGTGGAAGTGG + Intronic
987080153 5:14418859-14418881 CAGTAAACTCCGTGGGGACAGGG - Intronic
987115989 5:14727033-14727055 CATCACAGGCAGTGGGGACACGG + Intronic
988538514 5:32089300-32089322 CAGCACACACTGGGGGGACCTGG - Exonic
989351596 5:40493254-40493276 CAGGACACACAGAAAGGAAAGGG + Intergenic
992643777 5:78793386-78793408 CCTTACACATAGTGGGGACAGGG + Intronic
993616933 5:90124496-90124518 CATGACACACACTGGGGACAGGG + Intergenic
993668587 5:90731537-90731559 CAGGACACACTTTGGGCAGAGGG + Intronic
995230789 5:109760148-109760170 CACGACACACAGGGGCGTCAGGG - Intronic
996270671 5:121601123-121601145 AAGAACACACAATGGGGAAAGGG - Intergenic
996754287 5:126919859-126919881 CTGAACCCACAGTGGGGAGACGG + Intronic
998445304 5:142193879-142193901 CAGGTCACAAAGTTGGGGCATGG + Intergenic
999284398 5:150385636-150385658 CAAGTCACAGAGTGGGGAGAGGG - Intronic
999463008 5:151772590-151772612 CCGGACACACAGTGAGGGCGTGG - Intronic
999666157 5:153916086-153916108 AAGGACACAGAGTGGGGAGCTGG - Intergenic
1000821935 5:165995487-165995509 CCGGAGACACAGAGGGGAGAAGG + Intergenic
1000986996 5:167871764-167871786 CAGTACATAAAGTGGGAACAAGG + Intronic
1001495474 5:172185191-172185213 CAGGACACACTGCGGGGAAGGGG + Intronic
1001759273 5:174194120-174194142 CTGAATACACAGTAGGGACAGGG + Intronic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1002310965 5:178313535-178313557 AAGGTCACACAGTGGAGAAATGG + Intronic
1002616191 5:180458013-180458035 TAGGACACACAGGAAGGACAGGG + Intergenic
1002754676 6:148059-148081 CAGCACACACCTTGGGGGCACGG - Intergenic
1002791639 6:441571-441593 CAGGACCCACAGAGGGGTCTCGG + Intergenic
1003903478 6:10677273-10677295 AAGAACACACAATGGGGAAAAGG - Intronic
1005298480 6:24449016-24449038 CAGGATGCTAAGTGGGGACAAGG + Intronic
1005768049 6:29034722-29034744 AAGAACACACAATGGGGACAGGG - Intergenic
1006382095 6:33704915-33704937 CAGGACAGACAGGAGGGGCATGG + Intronic
1007706690 6:43795475-43795497 GAGGGCACGCAGTGGGGAAAGGG + Intergenic
1007833862 6:44659296-44659318 CTGGGCACACAGTGGCGGCAAGG + Intergenic
1009705030 6:67239032-67239054 CAGGGGACTCAGAGGGGACAGGG - Intergenic
1010088203 6:71946514-71946536 AAGAACACACAATGGGGAAAAGG + Intronic
1011236870 6:85228019-85228041 CATGACACATATTGGAGACATGG - Intergenic
1012908187 6:105091421-105091443 CAGGACCCACAGGACGGACAGGG - Intergenic
1013280153 6:108628636-108628658 CAGGACATGGAGTGGAGACAGGG + Intronic
1014486767 6:122008661-122008683 CAGGTGACAAAGTGGTGACATGG + Intergenic
1015652595 6:135479548-135479570 CAAGATACAATGTGGGGACAGGG - Intronic
1017047781 6:150363551-150363573 CAGGACACTCTGTGGGCACCCGG + Intergenic
1017968046 6:159284038-159284060 CAGGTCACACAATGGCCACAAGG + Intergenic
1018031011 6:159841750-159841772 CAGGAGACATAGTAGGAACAGGG - Intergenic
1018176194 6:161181386-161181408 GAGGGGACAGAGTGGGGACAAGG - Intronic
1018985504 6:168633647-168633669 CAGGAGACACAGAAGGGCCAAGG + Intronic
1019593016 7:1845011-1845033 CTGGACTCACAGTGGGCACAGGG + Intronic
1020136680 7:5591904-5591926 CTGGTCACACAGGAGGGACATGG - Intergenic
1020243301 7:6411823-6411845 CATGGCAGAGAGTGGGGACAAGG - Intronic
1021383567 7:19999975-19999997 CAGAACACACAATGGGGAAAGGG + Intergenic
1021951152 7:25776355-25776377 CATAACACACAGTGATGACAGGG - Intergenic
1022628227 7:32060296-32060318 AAGGGCACAGAGTGGGGAGAGGG - Intronic
1022633118 7:32104641-32104663 GAGGATACAGAGTGGGGAAATGG + Intronic
1024283467 7:47737820-47737842 CAGGGCAGACAGTGGCAACAGGG + Intronic
1024611293 7:51066427-51066449 CAGGACACAGAGTAGGGAGGAGG + Intronic
1024961086 7:54977503-54977525 CAGGGTAGACAGTGGAGACACGG + Intergenic
1025830395 7:65044091-65044113 CAGGGCCCACAGTGTGGACTTGG - Intergenic
1026358983 7:69585417-69585439 CAGAAGACACAGTGGGACCAGGG - Intergenic
1026524817 7:71144667-71144689 CAGGGCACAGAGTGAGGAGATGG + Intronic
1026991563 7:74588916-74588938 CAGGACACACTTAGGAGACAAGG - Intronic
1027420412 7:78012846-78012868 CAGGAGCCACACTGGGGAGATGG - Intergenic
1027474335 7:78610437-78610459 CAGGGAACACAGTGGAGACCTGG + Intronic
1028983488 7:96992597-96992619 CAGGACACCCTGTGCGGGCATGG - Intergenic
1029480941 7:100812650-100812672 CAGGACAGACAGTGGGTCCCAGG - Intronic
1029690028 7:102175188-102175210 CTGGACCCAGAGTGGGGACCGGG - Intronic
1032019852 7:128401198-128401220 CAGGACAGGCCCTGGGGACATGG + Intronic
1032661764 7:133991710-133991732 AAGAACACACATTGGGGAAAGGG - Intronic
1032802179 7:135325611-135325633 CAGGGCACCCAGTTTGGACAGGG - Intergenic
1033595883 7:142857329-142857351 CAGGACAGACAGTGAGGAGGTGG - Intronic
1034855212 7:154539184-154539206 CAGGGCCCACAGTGGGGAGAAGG - Intronic
1035312074 7:157975792-157975814 CAGGGCACACAGTAGGTACCTGG - Intronic
1035375407 7:158404155-158404177 CAGGACACACTGTGGCCCCAAGG + Intronic
1035651218 8:1266821-1266843 CTGCACACACAATGGGGAGAGGG - Intergenic
1035849414 8:2900440-2900462 TAGGACAGAGAGTGGGGAAAGGG + Intergenic
1036663298 8:10722197-10722219 CAGGACACACTGTGGGGGCATGG - Intergenic
1037916863 8:22778144-22778166 CAGGACAAGCAGTAGAGACAGGG - Intronic
1037993023 8:23333822-23333844 CAGGACGCAGAGGGTGGACAAGG + Intronic
1038301510 8:26354655-26354677 AGGTACACACAGTGGGCACATGG - Intronic
1039135775 8:34321317-34321339 CAGGGATCACAGTGGGGTCATGG - Intergenic
1041171593 8:55147954-55147976 TTGGACTCTCAGTGGGGACAGGG + Intronic
1041267668 8:56081044-56081066 CAGGACAAAGAGAGGAGACAGGG - Intergenic
1041906765 8:63041207-63041229 AAGAACACACAATGGGGAAAGGG - Intergenic
1042276671 8:67012285-67012307 CAGGACACATAAATGGGACATGG - Intronic
1042835340 8:73074785-73074807 GAGGGCACACAGTGGGTGCAGGG + Intronic
1044555006 8:93553560-93553582 CAGGAGACTGAGTGAGGACAGGG - Intergenic
1044784485 8:95780129-95780151 CATGCCAGACAGTGGGGACAGGG + Intergenic
1046215180 8:111136194-111136216 AAGAACACACATTGGGGATAGGG - Intergenic
1048160552 8:132016973-132016995 CAAGACACACAGCGGGGAATGGG + Intergenic
1048504448 8:135008148-135008170 CAGGTCACACAGTGGTGACTGGG + Intergenic
1048893806 8:138970811-138970833 CAGGGCACCCAGTGAGGAGATGG + Intergenic
1049075548 8:140393291-140393313 CAGGTCGCACAGTGAGGAAATGG + Intronic
1049371374 8:142269354-142269376 CAGGACACAGTGTGGGGTGAAGG + Intronic
1049503130 8:142978725-142978747 CTGGAGAGACAGAGGGGACATGG + Intergenic
1049761573 8:144334163-144334185 CAGGACACACACGGGGGATGGGG + Intronic
1050981428 9:12020671-12020693 CATGAGAAACAGTGGGTACATGG - Intergenic
1051824111 9:21199328-21199350 CAGCACACTCAGTGGGAAAATGG - Intergenic
1052144702 9:25034748-25034770 AAGGACACACAATGGTGAAAGGG + Intergenic
1052740177 9:32384920-32384942 CATGACATAGACTGGGGACAGGG - Intronic
1052978835 9:34432269-34432291 CAGGACTCACAGTGAGGAGCAGG - Intronic
1053002705 9:34586059-34586081 GAGCCCACACAGTAGGGACATGG - Intronic
1053274231 9:36771155-36771177 AAGGTCACACAGGGGGCACATGG - Intergenic
1054710039 9:68502155-68502177 AAGGACACAGAGTGGGATCAGGG - Intronic
1057317450 9:93978921-93978943 CAGGACACACAAGTGAGACAGGG + Intergenic
1058766696 9:108188903-108188925 CAGGTCACATAGCTGGGACATGG - Intergenic
1060082673 9:120665854-120665876 CAGAACACACATTGGGGGAAAGG - Intronic
1060507983 9:124212728-124212750 CAGGACACACACATGGGAGAAGG - Intergenic
1060886220 9:127154280-127154302 CAGGACACCCTGTGGACACAAGG - Intronic
1061218557 9:129235841-129235863 AAGGACACACAGTGGGTGCAGGG + Intergenic
1061450824 9:130666154-130666176 CTGGACACACAGTGGGCTCCCGG + Intronic
1061572421 9:131485968-131485990 CAGGGGACTCAGTGGGGACGAGG - Intronic
1061634412 9:131897944-131897966 CAGCACATAAAATGGGGACATGG - Intronic
1062170505 9:135132384-135132406 CAGGACACAGAGTGGCGGAAGGG - Intergenic
1062186191 9:135219924-135219946 GAGGCCACACAGCGGGGAAATGG + Intergenic
1062539157 9:137034088-137034110 CCGGCCCCACAGTGAGGACAAGG + Intronic
1203455138 Un_GL000219v1:159949-159971 CAAGAAACAAAGTGGGGTCAAGG - Intergenic
1187721286 X:22153505-22153527 GAGAACACAGAGTGGGGATACGG + Intronic
1189338589 X:40186925-40186947 CAGGAATCACAGTGAGGGCATGG + Intergenic
1189384211 X:40524058-40524080 CAGTTCCCACATTGGGGACATGG + Intergenic
1190344043 X:49321777-49321799 CCGGACCCACCATGGGGACAAGG - Intergenic
1190345137 X:49331322-49331344 CCGGACCCACCATGGGGACAAGG - Intergenic
1190346231 X:49340888-49340910 CCGGACCCACCATGGGGACAAGG - Intergenic
1190347483 X:49531917-49531939 CCGGACCCACCATGGGGACAAGG - Intergenic
1190348584 X:49541473-49541495 CCGGACCCACCATGGGGACAAGG - Intergenic
1190349685 X:49551029-49551051 CCGGACCCACCATGGGGACAAGG - Intergenic
1190350789 X:49560582-49560604 CCGGACCCACCATGGGGACAAGG - Intronic
1190351890 X:49570140-49570162 CCGGACCCACCATGGGGACAAGG - Intergenic
1190352991 X:49579689-49579711 CCGGACCCACCATGGGGACAAGG - Intergenic
1190354092 X:49589236-49589258 CCGGACCCACCATGGGGACAAGG - Intergenic
1190355194 X:49598760-49598782 CCGGACCCACCATGGGGACAAGG - Intronic
1190517620 X:51241204-51241226 AAGAACACACATTGGGGAAAGGG + Intergenic
1190735510 X:53253375-53253397 AAGGCCACACAGTTGGGAAATGG + Intronic
1191722062 X:64239478-64239500 AAGGCCACTCAGTGGGGAAAAGG - Intergenic
1192258543 X:69487846-69487868 AAGAACACACATTGGGGAAAGGG - Intergenic
1193858237 X:86632581-86632603 AAGAATACACAATGGGGACAAGG + Intronic
1197166816 X:123386716-123386738 AAGGACATACACTGGGGAAAGGG - Intronic
1197518923 X:127473208-127473230 AAGACCACACAGTGGGGTCAGGG - Intergenic