ID: 985640541

View in Genome Browser
Species Human (GRCh38)
Location 5:1061514-1061536
Sequence GCGGATGCGGCAGGTGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 2, 1: 2, 2: 2, 3: 31, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985640541_985640553 20 Left 985640541 5:1061514-1061536 CCCGCCGCACCTGCCGCATCCGC 0: 2
1: 2
2: 2
3: 31
4: 343
Right 985640553 5:1061557-1061579 CACCCACCGCACCCGCCGTGCGG No data
985640541_985640554 21 Left 985640541 5:1061514-1061536 CCCGCCGCACCTGCCGCATCCGC 0: 2
1: 2
2: 2
3: 31
4: 343
Right 985640554 5:1061558-1061580 ACCCACCGCACCCGCCGTGCGGG 0: 4
1: 6
2: 1
3: 19
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985640541 Original CRISPR GCGGATGCGGCAGGTGCGGC GGG (reversed) Intronic