ID: 985641207

View in Genome Browser
Species Human (GRCh38)
Location 5:1064294-1064316
Sequence GGTGCGGAAGGGGCCTCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985641197_985641207 2 Left 985641197 5:1064269-1064291 CCGTCCGCAGGTCATCTGAGGCC 0: 1
1: 0
2: 0
3: 14
4: 105
Right 985641207 5:1064294-1064316 GGTGCGGAAGGGGCCTCCCCGGG 0: 1
1: 0
2: 1
3: 23
4: 232
985641199_985641207 -2 Left 985641199 5:1064273-1064295 CCGCAGGTCATCTGAGGCCAGGG 0: 1
1: 0
2: 2
3: 31
4: 305
Right 985641207 5:1064294-1064316 GGTGCGGAAGGGGCCTCCCCGGG 0: 1
1: 0
2: 1
3: 23
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985641207 Original CRISPR GGTGCGGAAGGGGCCTCCCC GGG Intronic
900346843 1:2214254-2214276 GGGGCGGGAGGGGCCTGCTCGGG + Intergenic
900399846 1:2468443-2468465 AGTGCTGAAGGGGCCTGCCCAGG - Intronic
900534908 1:3171983-3172005 GGTGCTGAAGGAGCATCCCTGGG + Intronic
900556931 1:3285251-3285273 GGAGAGGCAGGGGCCTCCACGGG - Intronic
900801752 1:4741346-4741368 GGCCGGGAAGGGTCCTCCCCTGG - Intronic
901231161 1:7642333-7642355 GGGGGGGAAGGGACCTGCCCAGG + Intronic
901921712 1:12541634-12541656 GGGGAGGAAGGGGCCTTCCCGGG + Intergenic
903190241 1:21652085-21652107 GGTGGGGGAGGGGCTGCCCCGGG - Intronic
903333768 1:22611669-22611691 GGTGCTGAAGCGGCATCCGCTGG + Intergenic
903358507 1:22762598-22762620 TGAGGGGAAGGGGCTTCCCCAGG - Intronic
904031459 1:27536057-27536079 GATGCTGAAAGGGCCTCCTCAGG + Intronic
904295594 1:29517859-29517881 GGTGTGGATGGGGCCTCTCCAGG + Intergenic
904467424 1:30716723-30716745 GGAGGTGATGGGGCCTCCCCAGG - Intronic
904491686 1:30864406-30864428 GGAGGTGAAGGGGCTTCCCCAGG + Intergenic
905229936 1:36508680-36508702 GATGCTGCAGGGGGCTCCCCCGG - Intergenic
905546590 1:38804674-38804696 GGGACGGAAGGGGCCTCTCTGGG - Intergenic
906284986 1:44581403-44581425 GGAGAGCAAAGGGCCTCCCCAGG + Intronic
906524497 1:46486303-46486325 GGTGGGGCTGGGGCCTGCCCTGG + Intergenic
906960073 1:50414942-50414964 CTTGCGGAAGTGGCCTTCCCCGG + Intergenic
907284360 1:53370583-53370605 GGTGGTGACTGGGCCTCCCCTGG + Intergenic
910703804 1:90105109-90105131 GGTGAGGAAGGGGCCAGCTCTGG - Intergenic
915185189 1:154099118-154099140 TGTGCAGAAGGGGCCTTCCTGGG + Intronic
919976813 1:202618242-202618264 TGTGGGGAAGTGGCCTTCCCAGG + Intronic
922466616 1:225849076-225849098 GCTGAGGAAGGGGCCGCACCTGG + Intronic
1064596648 10:16952367-16952389 GGTGAGGATGTGGCCTCCGCAGG + Exonic
1066059191 10:31707305-31707327 GGTGGGCCAGGGGCCTCCTCAGG - Intergenic
1066464703 10:35641621-35641643 AGTGCGGAAGGGCCCTGCCCAGG - Exonic
1067295923 10:44975187-44975209 GAAACGGAAGGGGCTTCCCCTGG + Intronic
1067802785 10:49370605-49370627 GCTGCCAAAGGGGCTTCCCCTGG + Intronic
1072535701 10:96360943-96360965 AGTGAGGCAGGGGCATCCCCAGG + Intergenic
1073124583 10:101141466-101141488 GGGGTGGGAGGGGCCTCCCTGGG - Intergenic
1073425272 10:103452134-103452156 GGTAAGGAAGGGGCCCTCCCTGG - Exonic
1076898582 10:133325937-133325959 GGAGCGCAAGGGGCCCACCCAGG - Exonic
1077298505 11:1836921-1836943 GTTGCCGAAGGGGCATCCCAGGG - Intronic
1079682451 11:23315519-23315541 GGTGGTGAAAGAGCCTCCCCAGG - Intergenic
1082767795 11:57182469-57182491 GCTGCGGAGGGTGCATCCCCAGG + Exonic
1083173917 11:60937848-60937870 GGTGAGTATGGGGCCTCCCCAGG - Exonic
1083420807 11:62552021-62552043 GGAGGGGAAGGGGAATCCCCTGG - Intronic
1083695786 11:64441353-64441375 GGGGCATGAGGGGCCTCCCCGGG - Intergenic
1083878508 11:65537135-65537157 GGGGCTGAGGGAGCCTCCCCAGG + Intronic
1084669355 11:70596189-70596211 GGCGGGGAAGGGGGCTCGCCTGG - Intronic
1084751010 11:71204534-71204556 GCTGCGGCAAGGGACTCCCCAGG + Intronic
1084834337 11:71791920-71791942 AGTATGGCAGGGGCCTCCCCAGG + Intronic
1085052919 11:73388962-73388984 GGTGTGGAGCCGGCCTCCCCGGG + Intronic
1085322584 11:75583829-75583851 GGTGGGGAAGGGGACGCCGCGGG + Intergenic
1089567880 11:119381628-119381650 GGCCCAGAAGGGACCTCCCCGGG + Exonic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090363465 11:126188587-126188609 GGTGGGGAGGGGGCCTTCCTGGG - Intergenic
1091108681 11:132944780-132944802 GGAGCGGAGAGGGCCTCCCGAGG - Intronic
1091300904 11:134507692-134507714 GGTGAGAAAGGGGCATCTCCAGG - Intergenic
1092182786 12:6457584-6457606 TGTGCGGAAGGGCGCTACCCTGG + Exonic
1096100893 12:48969974-48969996 GCTCCGGGAGGGGCCTCTCCTGG - Intronic
1097595256 12:61621105-61621127 GGGGAGGATGGGGCCTCCCTCGG - Intergenic
1097896020 12:64825224-64825246 GGTGGGGCAGCGGCCACCCCAGG + Intronic
1098036042 12:66302790-66302812 GGTGAGGAAGGCGTCTGCCCGGG + Exonic
1098199550 12:68040205-68040227 GGTGCCTAAATGGCCTCCCCAGG - Intergenic
1101794895 12:107963983-107964005 AGTGCTGAAGGAGCCACCCCCGG - Intergenic
1102206092 12:111091747-111091769 GGTGAGGAAGGACCCTCCCCTGG - Intronic
1102217084 12:111169273-111169295 GGCGAGGAAGGACCCTCCCCTGG + Intronic
1102493324 12:113302337-113302359 GGTGAGGAAGGATCCTCCTCTGG + Intronic
1103801295 12:123539319-123539341 GGCAAGGAAGGGTCCTCCCCTGG - Intergenic
1104310551 12:127650932-127650954 AGGGCAGAAGGGGCCTCCCTGGG + Intergenic
1104376333 12:128267575-128267597 GGTGCGGCGGGGGCCTCGGCGGG + Intronic
1104667950 12:130660704-130660726 GGTGAGGTGGGGGCCTTCCCTGG + Intronic
1104820614 12:131675371-131675393 AGAGAGGACGGGGCCTCCCCTGG + Intergenic
1104820626 12:131675410-131675432 AGAGAGGACGGGGCCTCCCCTGG + Intergenic
1104820638 12:131675449-131675471 AGAGAGGACGGGGCCTCCCCTGG + Intergenic
1104820651 12:131675488-131675510 AGAGAGGATGGGGCCTCCCCTGG + Intergenic
1104920195 12:132286487-132286509 GGGGCGGGAGGGGCGTCTCCTGG - Intronic
1105853750 13:24358347-24358369 GGTGGGGATGGGGCCCCCCAGGG - Intergenic
1106464945 13:30005156-30005178 GGTGTGGGAGGAGCCTCCCTAGG + Intergenic
1113628710 13:111865411-111865433 GCTGCGGAAAGGGCTTCTCCAGG + Intergenic
1114477518 14:23007280-23007302 GGTAGGGGAGGGGCCTCCTCAGG + Intronic
1114626123 14:24131493-24131515 GGGGCTGATGGGGCCCCCCCTGG - Exonic
1116821865 14:49634483-49634505 GGAGCCGAAGGGTCCTCTCCCGG - Exonic
1118380630 14:65214790-65214812 GGTGGAGGAGTGGCCTCCCCTGG - Intergenic
1118852331 14:69593502-69593524 GGGGCTGACGGGGGCTCCCCAGG - Intergenic
1119160493 14:72448156-72448178 GGTGGGTAAGGGACCTGCCCAGG + Intronic
1119341922 14:73886705-73886727 GGTGCTGGCGGGGCCTCCCCAGG - Exonic
1121981795 14:98460904-98460926 GCTGCTGAAGGGGCAGCCCCAGG - Intergenic
1122657764 14:103273642-103273664 GGTGCGGCAGAGGCGTCCGCTGG - Intergenic
1122799309 14:104221796-104221818 GGTGCGGTGGGGGCACCCCCTGG + Intergenic
1122890029 14:104727929-104727951 CGGGCTGAAGGGGCCTGCCCTGG + Intronic
1122901062 14:104782522-104782544 GGTGCGGGAGGGGCAGGCCCAGG + Intronic
1123113285 14:105882734-105882756 GGGGCTGAGGGGTCCTCCCCAGG + Intergenic
1123827281 15:24094777-24094799 GCTGGGGAAGGATCCTCCCCAGG - Intergenic
1123851818 15:24365257-24365279 CGTGGGGAAGGATCCTCCCCAGG - Intergenic
1123856753 15:24420207-24420229 CGTGGGGAAGGATCCTCCCCAGG - Intergenic
1123861306 15:24470104-24470126 CGTGGGGAAGGATCCTCCCCAGG - Intergenic
1124414811 15:29466414-29466436 GGTGCAGCAGTGTCCTCCCCTGG - Intronic
1128153912 15:65379949-65379971 GGAGGGGAAGGGCCCTCCCTGGG + Intergenic
1128398712 15:67254947-67254969 GGTGGGAAACGGGCTTCCCCCGG + Exonic
1129119684 15:73388458-73388480 GAAGAGGGAGGGGCCTCCCCTGG + Intergenic
1129264483 15:74386571-74386593 GGAGAAGGAGGGGCCTCCCCAGG + Intergenic
1130439845 15:83942675-83942697 GGAGGGGCAGGGGTCTCCCCTGG - Exonic
1130995579 15:88902001-88902023 GGTGGAGCAGGGGCCTTCCCTGG - Intronic
1132661122 16:1062004-1062026 GGAGCGGTAGGGCCCTCCCCTGG + Intergenic
1133176781 16:4021457-4021479 GGTGGGTAGGGGGCCTCCCGAGG - Intronic
1135294609 16:21268410-21268432 GGTGGGGCAGCGGCCTCACCAGG + Intronic
1136268927 16:29137131-29137153 AGGCCGGAAGGGGCCTCCCCGGG + Intergenic
1137564875 16:49526633-49526655 GGTGGGGATGGGGAATCCCCTGG + Intronic
1137675377 16:50301318-50301340 GGTGGGGAAGGGCCCTGCCTGGG + Intronic
1141310208 16:82906744-82906766 GGTGGGGAAGGATCCTCCCCTGG - Intronic
1141464318 16:84196252-84196274 GGTTCGGAAGGGGCCACCGGGGG - Exonic
1141470847 16:84237335-84237357 GGTGCGGAAGGTGGGTGCCCTGG - Exonic
1141829243 16:86500496-86500518 GGAGCTGGTGGGGCCTCCCCAGG + Intergenic
1141839778 16:86567204-86567226 GGAGCGGGAGGGGCGGCCCCGGG - Intergenic
1142142969 16:88480721-88480743 GGCACCGCAGGGGCCTCCCCAGG + Intronic
1143108662 17:4541754-4541776 GGTGGGGAAAGGGCGCCCCCCGG + Intronic
1144515942 17:15917647-15917669 CCAGCGGCAGGGGCCTCCCCAGG + Intergenic
1145141370 17:20450907-20450929 GGTGCGGGTGTGGCCTCTCCAGG - Intronic
1145933940 17:28704263-28704285 GATGGGGAAGGGGCCTCTACAGG - Intronic
1147250618 17:39150978-39151000 GCTGGGGCAGGGGCCTCCCCAGG + Intronic
1148832208 17:50440971-50440993 GCTGCTGAAGGGGCCATCCCGGG + Intronic
1151791338 17:76307743-76307765 GGTGCCCAAGGGGGCGCCCCGGG - Intergenic
1152400990 17:80066018-80066040 GGGGAGGAAGAGGCCTCCTCTGG + Intronic
1152526320 17:80890094-80890116 GCTGCGCACGGGGCCTCCCTCGG - Intronic
1152782346 17:82231894-82231916 GCTGCGCAAGGGGCTGCCCCAGG - Intronic
1157202123 18:45668305-45668327 GGTGGAGCAGGGGCTTCCCCAGG - Intronic
1159842737 18:73417760-73417782 GGAGCAGAAGGAGCTTCCCCAGG - Intergenic
1160763791 19:798188-798210 GGGGCCGGAGGGGCCTCTCCAGG + Intronic
1160845231 19:1163364-1163386 GGGCAGGAAGGGTCCTCCCCTGG + Intronic
1160916051 19:1497247-1497269 GGTGAGGAGGGGGCCGCGCCAGG + Exonic
1161222246 19:3123077-3123099 GGAGCAGATGGGGCCACCCCTGG + Exonic
1162021429 19:7870134-7870156 GGTGAGAAAGGGGCCTGCCCAGG + Exonic
1162027766 19:7904120-7904142 GGTGGGGGCGGGGCCTCCCGCGG - Intronic
1162944054 19:14031737-14031759 GGTGCGGAGGCGGCCTGCCGGGG + Exonic
1163412253 19:17162499-17162521 AGTGAGGATGTGGCCTCCCCTGG - Intronic
1165786174 19:38463316-38463338 GGTGCTGGAGGAGCCTCCCAGGG + Intronic
1166267854 19:41696080-41696102 GCTACTGAAAGGGCCTCCCCAGG + Intronic
1166355399 19:42224527-42224549 GATGAGGCAAGGGCCTCCCCAGG - Exonic
1166499824 19:43332425-43332447 GCTACTGAAAGGGCCTCCCCAGG - Intergenic
1167434985 19:49474242-49474264 GGTGTGGAAGGGGCCAAGCCGGG - Intronic
1167538303 19:50069444-50069466 GGTGAGGAAGGACCCTCCCCTGG + Intergenic
1167610569 19:50506055-50506077 GGAGGGGGCGGGGCCTCCCCAGG + Exonic
1168712740 19:58511310-58511332 AGTGCGCCAGGGGCATCCCCCGG + Exonic
924988367 2:289919-289941 GGCGCAGACGGGGCCTCTCCGGG - Intergenic
925103920 2:1272810-1272832 GGTGCAGAAAGGGCATCCCAGGG + Intronic
926171726 2:10556919-10556941 GGCCGGGAAGGAGCCTCCCCAGG + Intergenic
927673574 2:25089024-25089046 GCTGGGGAAGGTGCCTTCCCTGG + Intronic
927713758 2:25340768-25340790 GGTGCTGGAGGGGCGACCCCGGG + Intronic
932326157 2:70863231-70863253 GGTGAGGAAGGATTCTCCCCTGG - Intergenic
933284902 2:80375264-80375286 GGAGGGAAAAGGGCCTCCCCAGG + Intronic
937872684 2:126797469-126797491 GGGGCAGACGGGGCCTCCACAGG - Intergenic
943064325 2:183070870-183070892 GATGGGCAAGGGGGCTCCCCAGG + Intergenic
946314990 2:218905322-218905344 GGAACTGAAGGGGCCTGCCCAGG - Intergenic
947791385 2:232871267-232871289 GTGGCCGAGGGGGCCTCCCCAGG - Intronic
1172130623 20:32652514-32652536 GGTGCTGATGGAGCCTCCTCTGG + Intergenic
1172624662 20:36340309-36340331 GGTGCGGCATGGGCATCCCAAGG - Intronic
1172626496 20:36350394-36350416 GATGGAGAAGGGGCCTCCTCAGG - Intronic
1172671255 20:36635758-36635780 GGAGGGGAAGGGGCCCTCCCAGG - Intronic
1173907613 20:46640325-46640347 GGTGGGGAAGGGACTTCACCAGG + Intronic
1174944382 20:54969105-54969127 GGTGTGGAAGGGGACTGTCCTGG - Intergenic
1175741475 20:61422701-61422723 GCTGCAGAAGGGGCCTCATCTGG + Intronic
1175902538 20:62365860-62365882 GAGGGGGAAGGAGCCTCCCCAGG - Intronic
1175930077 20:62489719-62489741 GGAGGGCAAGGGGCCGCCCCAGG + Intergenic
1176150226 20:63586982-63587004 GGGGAGGAAGGGGCCCCCCTGGG + Intergenic
1178719704 21:34997763-34997785 AGTGCAGAAGGGGCCTTGCCAGG + Intronic
1178972800 21:37195804-37195826 AGCGCAGAAGGAGCCTCCCCTGG - Exonic
1180149367 21:45939873-45939895 GGTGTGGGCGGGGCCTCTCCGGG + Intronic
1180180213 21:46115577-46115599 GGTGCAGAAGGGACCCCCACGGG + Intronic
1180888924 22:19271048-19271070 GGTGAGGAGGGGGCCTCCAGGGG + Intronic
1180942141 22:19666399-19666421 GATGATGAAGGGGCCTCTCCCGG + Intergenic
1181393269 22:22599417-22599439 GGAGAGGAAGGCCCCTCCCCAGG + Intergenic
1181474066 22:23157926-23157948 GGCGAGCAAGGGGGCTCCCCAGG - Intronic
1181559240 22:23690452-23690474 GGAGGGGATGAGGCCTCCCCAGG + Intronic
1182362142 22:29752952-29752974 GGTCAGGGAGGGGCCTGCCCAGG - Intronic
1182508542 22:30802773-30802795 GGGGCGGAGGGAGCCTCCTCGGG + Intronic
1182719246 22:32384376-32384398 GGAGGGGACGAGGCCTCCCCAGG + Intergenic
1183176093 22:36225732-36225754 GGTGCCGATGGAGGCTCCCCTGG - Intergenic
1183182239 22:36267982-36268004 GGTGCCGATGGAGGCTCCCCTGG + Intergenic
1183315961 22:37136922-37136944 GGTGTCCAAGGGGCCTTCCCTGG + Intronic
1183404973 22:37625949-37625971 GGTGAGGAAGGGGCCAGGCCTGG + Exonic
1183951655 22:41356077-41356099 GGGGCGGGCGGGCCCTCCCCCGG + Intronic
1184386808 22:44181395-44181417 GGAGAGGAAGGGGCCTGGCCCGG + Intronic
1184458776 22:44625696-44625718 GGAGGGGAAGGGGCCTCCCTGGG - Intergenic
1184869040 22:47221935-47221957 GGTGTGGAAGGATCCTCTCCTGG + Intergenic
1185068603 22:48644293-48644315 GGGGCAGCAGGGGCCTCCCCTGG - Intronic
1185106792 22:48875502-48875524 GGTGTGGAAGGGGTATCCTCTGG - Intergenic
1185182153 22:49369726-49369748 GGTGAGGCAGGGGCCTGCACTGG + Intergenic
1185332116 22:50256548-50256570 GGTGGGGCAGGGGCCCCCTCTGG - Intronic
951611428 3:24495450-24495472 GGTGCGGAGGCGGCCGGCCCGGG - Intergenic
954200482 3:49020867-49020889 GGGGAGGTGGGGGCCTCCCCTGG + Intronic
954408554 3:50359098-50359120 GGTAGGCCAGGGGCCTCCCCGGG + Exonic
954464581 3:50646989-50647011 GGTGGGGAAGGAGCCTCACTAGG - Intronic
954649413 3:52151136-52151158 GGTGAGGAAGGGGCTTCCCCAGG + Intronic
958418636 3:93906725-93906747 TGGGCAGAATGGGCCTCCCCAGG - Intronic
965571768 3:170180980-170181002 GGTGCACAAGAGGCCTACCCAGG + Intronic
967054940 3:185823750-185823772 GGTGGGGAAGGGGCTCCCGCCGG + Intronic
967236912 3:187393877-187393899 TGTGCGGAAAGGAACTCCCCAGG - Intergenic
968573267 4:1353502-1353524 GGGGATGCAGGGGCCTCCCCTGG + Intronic
968807813 4:2786901-2786923 GGTTCTGAAGGGGTCTCACCAGG - Intergenic
969336827 4:6515846-6515868 GGTGAGGAAGAATCCTCCCCTGG - Intronic
969531436 4:7733113-7733135 GGGGAGGAAGGGCCCTCCTCTGG - Intronic
969619039 4:8269792-8269814 AGGGCGGCAGGGGCATCCCCAGG - Exonic
972739573 4:41877650-41877672 GGTTAGGAAGGGGCCAGCCCTGG - Intergenic
976140892 4:81990466-81990488 AATGAGGAAGGGTCCTCCCCCGG + Intronic
980007499 4:127559031-127559053 GGGGCAGTAGGGGCCTTCCCAGG - Intergenic
980883930 4:138741531-138741553 GGTGAGGAGGTGGCCTCCACTGG - Intergenic
985323290 4:188738464-188738486 GGTCCGCAAGGGCCCGCCCCGGG - Intergenic
985537520 5:473427-473449 GGGGCGGGAGGGGCGTCCCCGGG + Intronic
985589722 5:758233-758255 GCAGAGGAAGGGGCTTCCCCTGG - Intronic
985641207 5:1064294-1064316 GGTGCGGAAGGGGCCTCCCCGGG + Intronic
985815275 5:2123975-2123997 GGGGTGGAAGGGGCTTCCCCAGG + Intergenic
992104212 5:73436832-73436854 GGTGAGGAAGGGGCGGCCGCGGG - Intergenic
996540809 5:124628958-124628980 GGTGAGCAAGTGGCCTTCCCGGG - Intergenic
1002199469 5:177519500-177519522 AGTGGGGAAGGGGCTGCCCCAGG + Intergenic
1006026109 6:31148218-31148240 AATGCAGAAGGGGCTTCCCCAGG + Intronic
1006316157 6:33293122-33293144 GGTGCAGAAGAGGCCTCCGGGGG - Exonic
1006806706 6:36793733-36793755 GGTGGGGAAGGGGCCTCCGGCGG - Intronic
1011090625 6:83594442-83594464 GATGCTGCAGGGGCCTCCCCAGG + Exonic
1015842231 6:137488396-137488418 GCTGGGGAAGGCGCCGCCCCCGG + Intergenic
1017313547 6:153002551-153002573 GGTCCGCAAGGGCCCGCCCCGGG + Exonic
1018710842 6:166497370-166497392 GGGACGGAAGGGGCTTCCACAGG + Intronic
1018786842 6:167114801-167114823 GCTAAGGACGGGGCCTCCCCTGG - Intergenic
1018950129 6:168373629-168373651 GGTGAAGAAGGGGCCTCCGGAGG - Intergenic
1019310886 7:360047-360069 GCTGCAGGAGGGGCATCCCCAGG + Intergenic
1019513364 7:1429346-1429368 GGGGCTGAAGGGGTCTCCTCTGG - Intronic
1019639888 7:2097671-2097693 GGTGCAGAAGGGCACGCCCCTGG + Intronic
1019662607 7:2233019-2233041 GGTGCGGACGCGGAGTCCCCAGG - Exonic
1024026124 7:45411232-45411254 GGTGAGGAAGGAACCACCCCTGG - Intergenic
1029174867 7:98657589-98657611 GGCAAGGAAGGGGCCTCCCCTGG + Intergenic
1033289684 7:140072736-140072758 GGTGAGGAAGGATTCTCCCCTGG + Intergenic
1034128910 7:148698573-148698595 GCCGCGGAAGGGGCGCCCCCGGG + Intronic
1034972290 7:155426818-155426840 GGAGAGGAAGGGCCCTCCCGAGG - Intergenic
1035375471 7:158404494-158404516 CGTGAGGACGGGGGCTCCCCAGG + Intronic
1036380425 8:8232975-8232997 GGCATGGCAGGGGCCTCCCCAGG + Intergenic
1036805588 8:11830420-11830442 GGTAGGGAAGGGGGCTCCTCTGG + Exonic
1037948683 8:23005044-23005066 GGTGTGGAAGGGGCCTCTTTGGG - Intronic
1040854231 8:51932282-51932304 GTTGTGGCAGGGACCTCCCCTGG + Intergenic
1042903124 8:73747280-73747302 GGTGTGGAAGGGGCTGCCCCAGG - Intronic
1043195436 8:77287086-77287108 GGTGCAGGAGGGGCCTTCCTGGG - Intergenic
1045137312 8:99234497-99234519 GGTAGGGAAGGGGCTTCCGCGGG + Intronic
1047615240 8:126557855-126557877 GGTGGGGAGGAGGCGTCCCCGGG - Intronic
1048332240 8:133478732-133478754 GGTGAGTTAGGGGCCTCTCCTGG + Intronic
1049566747 8:143344303-143344325 GGGGCAGAGGGGGCCTCCCACGG - Intronic
1049585336 8:143430295-143430317 GGTGAAGAAGGAGCCTCCCGAGG - Exonic
1049639146 8:143706704-143706726 GCTGCGGCAGAAGCCTCCCCGGG - Exonic
1056938291 9:90934738-90934760 GGTGAGCAAGGGGTCTGCCCTGG - Intergenic
1057550824 9:96049968-96049990 GGGGCGGTATGGGCTTCCCCAGG - Intergenic
1057758056 9:97853024-97853046 GGTGCGGAGGGGGCCGACCCGGG + Intergenic
1058187067 9:101867582-101867604 GGTTTGGAAGGGGCCTCCTATGG + Intergenic
1060989380 9:127839359-127839381 GGGGAGGAAGGTGCCTCCCAGGG + Intronic
1061232220 9:129321497-129321519 GGTGCGGAAAAGCCCTCCCTGGG - Intergenic
1061237812 9:129352380-129352402 GGGGCGGGAGGGGGCTCCCTGGG + Intergenic
1061532828 9:131228340-131228362 GGTTCCCAAGGGCCCTCCCCAGG - Intronic
1061907560 9:133706720-133706742 GGTTTGGAAGGGCCCTACCCAGG + Intronic
1061913090 9:133735158-133735180 GGTTTGGGAGGGGCCTGCCCAGG - Intronic
1062363096 9:136196787-136196809 GGAGAGGAGGGGGCCTCTCCCGG + Exonic
1062524171 9:136971633-136971655 GGGGAGGGAGGGGTCTCCCCAGG + Exonic
1062732849 9:138119315-138119337 CTTGTGGAAGGAGCCTCCCCCGG - Intronic
1185894082 X:3843228-3843250 GGCGGGGCAGGGCCCTCCCCAGG + Intronic
1185899200 X:3881652-3881674 GGCGGGGCAGGGCCCTCCCCAGG + Intergenic
1185904317 X:3920081-3920103 GGCGGGGCAGGGCCCTCCCCAGG + Intergenic
1186017525 X:5214414-5214436 GGTGCAGCAGGGGTCTCCGCTGG + Intergenic
1192924536 X:75741546-75741568 AGTGCAGAAGGAGCCTCCCCTGG + Intergenic
1193703464 X:84791524-84791546 GGTGGGGAAGGGGCCTTTGCTGG - Intergenic