ID: 985643614

View in Genome Browser
Species Human (GRCh38)
Location 5:1074869-1074891
Sequence CTGTGGCTGTGGAGGGAACG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 446}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985643596_985643614 26 Left 985643596 5:1074820-1074842 CCCTTGCCCTGAAGGGAGCCCGT 0: 1
1: 0
2: 0
3: 13
4: 142
Right 985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG 0: 1
1: 0
2: 2
3: 37
4: 446
985643605_985643614 3 Left 985643605 5:1074843-1074865 CCTAGGAGCCACCGGGTCAGAGG 0: 1
1: 0
2: 4
3: 16
4: 172
Right 985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG 0: 1
1: 0
2: 2
3: 37
4: 446
985643610_985643614 -8 Left 985643610 5:1074854-1074876 CCGGGTCAGAGGGTGCTGTGGCT 0: 1
1: 0
2: 3
3: 28
4: 248
Right 985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG 0: 1
1: 0
2: 2
3: 37
4: 446
985643597_985643614 25 Left 985643597 5:1074821-1074843 CCTTGCCCTGAAGGGAGCCCGTC 0: 1
1: 0
2: 0
3: 8
4: 125
Right 985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG 0: 1
1: 0
2: 2
3: 37
4: 446
985643594_985643614 30 Left 985643594 5:1074816-1074838 CCCACCCTTGCCCTGAAGGGAGC 0: 1
1: 0
2: 3
3: 40
4: 354
Right 985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG 0: 1
1: 0
2: 2
3: 37
4: 446
985643604_985643614 7 Left 985643604 5:1074839-1074861 CCGTCCTAGGAGCCACCGGGTCA 0: 1
1: 0
2: 0
3: 5
4: 101
Right 985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG 0: 1
1: 0
2: 2
3: 37
4: 446
985643595_985643614 29 Left 985643595 5:1074817-1074839 CCACCCTTGCCCTGAAGGGAGCC 0: 1
1: 0
2: 1
3: 28
4: 254
Right 985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG 0: 1
1: 0
2: 2
3: 37
4: 446
985643598_985643614 20 Left 985643598 5:1074826-1074848 CCCTGAAGGGAGCCCGTCCTAGG 0: 1
1: 0
2: 1
3: 9
4: 79
Right 985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG 0: 1
1: 0
2: 2
3: 37
4: 446
985643603_985643614 8 Left 985643603 5:1074838-1074860 CCCGTCCTAGGAGCCACCGGGTC 0: 1
1: 0
2: 0
3: 6
4: 85
Right 985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG 0: 1
1: 0
2: 2
3: 37
4: 446
985643608_985643614 -5 Left 985643608 5:1074851-1074873 CCACCGGGTCAGAGGGTGCTGTG 0: 1
1: 1
2: 0
3: 12
4: 436
Right 985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG 0: 1
1: 0
2: 2
3: 37
4: 446
985643600_985643614 19 Left 985643600 5:1074827-1074849 CCTGAAGGGAGCCCGTCCTAGGA 0: 1
1: 0
2: 0
3: 5
4: 219
Right 985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG 0: 1
1: 0
2: 2
3: 37
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985643614 Original CRISPR CTGTGGCTGTGGAGGGAACG AGG Intronic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
900319224 1:2074306-2074328 CGGTGGCTGTGGAGGGCTGGGGG + Intronic
900966941 1:5965397-5965419 CTGTGGACGTGGAGCGAATGTGG + Intronic
902650450 1:17833849-17833871 CTGTGCATGGGGAGGGAAAGGGG + Intergenic
903189564 1:21649199-21649221 CTTTGGAGGAGGAGGGAACGAGG - Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903946455 1:26966952-26966974 CTGGGGCTGTGGAGGAGCCGTGG + Intergenic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904570547 1:31461061-31461083 CTGTGGATGTGAAGGTAAGGAGG + Intergenic
904744568 1:32702879-32702901 CTGGGGCGGGGGTGGGAACGGGG + Exonic
905023189 1:34831992-34832014 CTCTGGCTGTGGAGGCAGCTGGG - Intronic
905090773 1:35429736-35429758 TTGAGGCTTTGGAGGGAACAAGG + Intergenic
905166543 1:36086471-36086493 CTGCGGGTGTGTAGGGCACGTGG + Intronic
905250160 1:36643297-36643319 CTGGGGCTGGGGATGGAACTGGG - Intergenic
905458547 1:38105498-38105520 ATGGAGCTGTGGAGGGAATGTGG + Intergenic
906660545 1:47578473-47578495 CTGAGGCTGTGGAGGGCTAGGGG - Intergenic
911102454 1:94105408-94105430 CTGTGGCTCTGGGGGGGAAGGGG + Intronic
911967641 1:104387595-104387617 CTGTGGCTGAGGAGTCAACCTGG - Intergenic
913013966 1:114713979-114714001 CTGGGGGTGTGGAGGGTAAGGGG + Intronic
913262338 1:117010900-117010922 CTGAGGATGTGGTGGGAAAGAGG - Intronic
913531173 1:119735350-119735372 CTGTGCCCGTGGAGGGATCGTGG + Exonic
914319409 1:146544832-146544854 CTGTGGCTGCAGGGGGAACCAGG + Intergenic
915073355 1:153290267-153290289 CTGTGACTGCTGAGGGAAAGAGG - Intergenic
915229469 1:154434872-154434894 CTGTGCATGGGGAGTGAACGGGG + Intronic
915254816 1:154619203-154619225 CTGGGGCTGGGGAGGGAACCTGG - Intronic
916752641 1:167737405-167737427 ATGAGGCTGGGGAGGGAACTGGG + Intronic
917745605 1:178003825-178003847 CTGTGTTTGTGGAGGGAGTGTGG + Intergenic
917755490 1:178094085-178094107 CTCTGGCTGGGGATGGAGCGGGG - Intergenic
918106779 1:181422262-181422284 CTGGGGATATGGAGTGAACGAGG - Intronic
920385538 1:205568599-205568621 CTGTGGCAGTGGAGGAAACCCGG - Intergenic
920750864 1:208675526-208675548 CTTTGGCTGTGGAGGAACCAAGG - Intergenic
922079336 1:222279628-222279650 TTGAGACTGTGGAGGGAACATGG + Intergenic
922466045 1:225846067-225846089 CTGTGGCTCTGGCAGGAAGGAGG - Exonic
923094127 1:230761256-230761278 CTGTGGCTGAGGAGTGGAAGAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923503137 1:234582809-234582831 CAGTGGCTGTGGCAGGAAGGGGG - Intergenic
924120808 1:240796024-240796046 GTGGGGCTGAGGCGGGAACGTGG - Intronic
1062902766 10:1158308-1158330 CTGTGGCTGTGCAGGTCACGTGG - Intergenic
1062972862 10:1661891-1661913 CTGCTGCTGGGGAGGGAAAGGGG + Intronic
1064014273 10:11760668-11760690 CTGTGTCAGTGGAGGGTAAGTGG + Intronic
1064553010 10:16521277-16521299 CTGCGGCTGGGGAGGGAGCGCGG + Exonic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067728351 10:48790608-48790630 CTCTGGCTGTGGATGGATGGTGG + Intronic
1069995228 10:72337735-72337757 CTGAGGCTGTGGAAAGAACAGGG - Intronic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1072049432 10:91688696-91688718 ATGAGGCTGTGGAGAGAAAGGGG + Intergenic
1072804021 10:98412858-98412880 CTGTGGCTGAGCACGGAAGGAGG + Intronic
1074882735 10:117671350-117671372 CTGGGGCTGTGGAGTGAACTGGG - Intergenic
1075342951 10:121661776-121661798 CTGGGACTCTGGAGGGAGCGTGG + Intergenic
1075713308 10:124542205-124542227 CAGTGGCTCTGGTGGGCACGGGG + Intronic
1075734981 10:124658999-124659021 CTGTGTCTGTGGTGGTAACCTGG + Intronic
1076693347 10:132234917-132234939 ATGTGGCTGTGAAGGGACCTAGG + Intronic
1076863750 10:133157133-133157155 CTGTGGCTCTGGCGGAAACACGG - Intergenic
1077030156 11:461869-461891 CTGTGGCTCTGGAGGCAGTGAGG + Intronic
1077037862 11:503955-503977 CTTTGGCTGTGTAGGGAGCCAGG - Intronic
1077119220 11:899211-899233 CTGTGCCTGGGGTGGGGACGGGG - Intronic
1077175424 11:1187712-1187734 CTGTGCTGGTGGTGGGAACGGGG - Intronic
1077175811 11:1189905-1189927 CTGTGCTGGTGGTGGGAACGGGG - Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077197935 11:1290730-1290752 AAGTGGCTGAGGAGGGAAAGAGG + Intronic
1077322817 11:1949875-1949897 CAGTGGCAGGGGCGGGAACGGGG + Intronic
1077385830 11:2269121-2269143 CTGAGGCTGCGGGGGGAAGGTGG + Exonic
1077934353 11:6768152-6768174 TTGGGGCTGTGGAAGGAACTGGG + Exonic
1077935970 11:6785821-6785843 CTGGTGCTGTGGAAGGAACTGGG - Exonic
1078918783 11:15807244-15807266 CTGTGGCTGTGGAGGAGGGGTGG - Intergenic
1079027498 11:16960688-16960710 CTGTGGCTGAGCAGGGACCCAGG - Intronic
1079085668 11:17443117-17443139 CTGCTGCTGTCGAGGGAAGGAGG + Intronic
1079314848 11:19398808-19398830 GTGTGTCTGTGGGGGGAAGGAGG - Intronic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1083163012 11:60867323-60867345 CTGTGGCTTTGGAAGGGAGGAGG - Intergenic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083381581 11:62273748-62273770 CTGTGCCTGTGGTGGGACTGGGG + Intergenic
1083611004 11:64004259-64004281 CTGGGGCAGTGGAGGGCACCAGG + Intronic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1084067809 11:66715390-66715412 CTTTGGCTGTGGAGGGACGGGGG + Exonic
1084612414 11:70212124-70212146 GTCTTGCTGTGGAGGGAACATGG - Intergenic
1084791272 11:71476715-71476737 CTGTGGCTCTGACGTGAACGGGG - Intronic
1084973682 11:72784932-72784954 CTGAGGTTGTGGGGGGCACGGGG + Intronic
1085041668 11:73330564-73330586 CTGTGGCTGTGGAGGGGCAGGGG + Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085277758 11:75310907-75310929 CTGTGGTTGTGGTGGGACAGAGG - Intronic
1085414439 11:76310894-76310916 CTGTGCCTCTGAAGGGCACGGGG + Intergenic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1086883861 11:92180786-92180808 CTGTGGCGGTGGGGTGAAGGTGG + Intergenic
1089943381 11:122442205-122442227 CTGTGGGTGTGGAAAGAATGGGG - Intergenic
1202805835 11_KI270721v1_random:5188-5210 CAGTGGCAGGGGCGGGAACGGGG + Intergenic
1091373758 12:13268-13290 CTGAGGCTGAGGAAGGAAAGGGG + Intergenic
1091407982 12:220885-220907 GGATGGCTGTGGAGGGAACGTGG - Exonic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092282478 12:7108531-7108553 CTGTGGGTGTGGGAGGAGCGGGG + Intronic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1093034215 12:14317877-14317899 CAGTGGCTCTGGAGGGAGCATGG - Intergenic
1095280758 12:40350061-40350083 CTGGGACTGTGCAGGGAGCGGGG - Intronic
1095580169 12:43788430-43788452 CTGTGGCTTTGCAGGGTGCGTGG - Intronic
1096722202 12:53531744-53531766 CTGTGGCTGGGCAGGGGATGGGG + Exonic
1096745657 12:53725309-53725331 CTGGAGCTGTGGGGGGAAGGAGG - Intronic
1097040342 12:56152593-56152615 CTGGGGCTGGGGAGGGGGCGGGG - Exonic
1100809650 12:98325406-98325428 CTGTGGCTGTGGACTGCAGGTGG - Intergenic
1101445317 12:104733201-104733223 ATGTAGCTGTGGAGGGCATGAGG + Intronic
1103414747 12:120736733-120736755 CCGTGGCTGTGGACGGAGCGGGG + Intronic
1103484046 12:121270826-121270848 CAGATACTGTGGAGGGAACGGGG - Intronic
1103879806 12:124157389-124157411 AGGTGGGAGTGGAGGGAACGAGG + Intronic
1104067589 12:125318255-125318277 CTGTGGTTGGGGAGGGACCACGG + Intronic
1104673933 12:130700082-130700104 GGGTGGCTGGGGAGGGAACATGG - Intronic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1104953887 12:132454500-132454522 GTGTGGGGGTTGAGGGAACGGGG + Intergenic
1105829004 13:24147750-24147772 CTAGGGGTGTGGAGGGAACGGGG - Intronic
1106420382 13:29580941-29580963 CTCTGGCGGTGGTGGGAATGTGG - Intronic
1107114043 13:36727211-36727233 CTGTTATTGTGGAGGGAACAGGG - Intergenic
1110032144 13:70629209-70629231 ATGTGGCAGTGGAGGGGAAGGGG + Intergenic
1110582092 13:77142493-77142515 CTTTGGCAGTGGAGGTAAAGAGG - Intronic
1110605221 13:77424615-77424637 ATGTGTCTGTGGTGGGAAGGGGG - Intergenic
1111522999 13:89428898-89428920 CTGTGGATATAGAGGGTACGAGG - Intergenic
1112181972 13:97091921-97091943 CAGAGGCTGGGGAGGGAAGGAGG + Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114649756 14:24277032-24277054 CTGTGGCTGTGGGGGGGCAGTGG + Intergenic
1114695937 14:24627845-24627867 CTGTGGCCCTGGAGGAAAAGAGG + Intergenic
1117839550 14:59845453-59845475 CTGTGGCAGTGGAGAGCAAGAGG - Intronic
1119644937 14:76341311-76341333 TGGTGGCTGGGGAGGGGACGAGG - Intronic
1120217811 14:81699319-81699341 CTATGACTTTGGAGGGAACAGGG - Intergenic
1120991856 14:90383938-90383960 CAGAGGCTGCGGAGTGAACGCGG + Intergenic
1121243518 14:92446948-92446970 CTGTGGGTGTGGGAGGAAAGGGG - Intronic
1121310355 14:92932382-92932404 CTCTGGCTGTGGATGGAGCTGGG + Exonic
1121331006 14:93049816-93049838 ATGTGGATGTGGAGGGACAGAGG + Intronic
1121414523 14:93770045-93770067 CTGTGGCTGTAGGGGGAGAGCGG - Intronic
1121787227 14:96671208-96671230 CTGCAGCTTTGGAGGGAAAGGGG - Intergenic
1122510689 14:102264825-102264847 CTGTGGCTCCGGAGGGAGCCTGG - Intronic
1122885361 14:104708151-104708173 CTGTGGTTGAGGTGGGGACGGGG + Intronic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1123047998 14:105527742-105527764 CTGGGGCTGTGGAGGGGGTGAGG + Intronic
1123726905 15:23112277-23112299 CTGGAGCAGTGGTGGGAACGTGG + Intergenic
1125516451 15:40323796-40323818 CTGTGGCTGTGGCGGCGGCGGGG + Intergenic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1125820700 15:42627580-42627602 CAGTGGCGGTAGAGGGAAAGGGG - Intronic
1128774798 15:70311995-70312017 CTGTGATTGAGGAGGGAACAGGG - Intergenic
1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG + Intergenic
1129220913 15:74131190-74131212 TTGTGGCTGTGGGGAAAACGGGG - Exonic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1132070785 15:98775220-98775242 ATGTGGAGGTGGGGGGAACGAGG - Intronic
1132731295 16:1363582-1363604 CTGTGGCCATGGCGGGCACGGGG - Exonic
1132771772 16:1567543-1567565 CTGTGGATGAGCAGGGAAGGAGG - Intronic
1132942492 16:2514857-2514879 GTGTGGAAGTGGAGGGAGCGGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1135597464 16:23755133-23755155 CGGCGGCTGCGGAGGGGACGGGG + Intronic
1135738290 16:24951286-24951308 CTGAGGCTTGGGAGGGAACAGGG - Intronic
1135778225 16:25275817-25275839 CTGTGCATGTGTAGGGAAGGGGG + Intergenic
1136591605 16:31221160-31221182 GTGTGGCCGTTGAGGGAAAGAGG + Intronic
1137580253 16:49629421-49629443 CTGTGGGTGTGGGTGGAAAGAGG - Intronic
1137716548 16:50601748-50601770 CTGTGGCTGTGGTGGGCTCAGGG + Intronic
1137737556 16:50736200-50736222 CTGGGCCTGTGTAGGGAACTAGG + Intergenic
1138219760 16:55240633-55240655 CTCTGGCTGAGGAGGGATTGAGG - Intergenic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138497266 16:57416180-57416202 CTGAGGCTGAGAAGGGCACGTGG + Intergenic
1138663809 16:58545430-58545452 CTGTGGCTGTGGTGGAACCGTGG + Exonic
1140014114 16:71165249-71165271 CTGTGGCTGCAGGGGGAACCAGG - Intronic
1141236364 16:82221462-82221484 CAGAGGCTGGGGAGGGAAGGAGG - Intergenic
1141717136 16:85733383-85733405 CAAGGGCTGGGGAGGGAACGGGG + Intronic
1141940998 16:87276158-87276180 GCGTGACTGCGGAGGGAACGGGG + Intronic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1142035716 16:87861213-87861235 CTGTGGCTGTCCAGGGTACCTGG + Intronic
1142043008 16:87907332-87907354 CTGTGTCTGTGGGGGAAAGGGGG + Intronic
1142194378 16:88732790-88732812 CTGTGGCTGTGGTGGGCTCCGGG - Intronic
1142419704 16:89962858-89962880 CTGTGGCTGTGCAGGGCTGGTGG + Intronic
1142478052 17:201401-201423 CTGTGGATCTGGGGGGAATGGGG - Intergenic
1142521454 17:507667-507689 TTGGGGCTGTGGAGGGAGGGAGG + Intergenic
1142676117 17:1514411-1514433 CTGTGCTGGTGGAGGGAATGGGG + Intronic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1143272110 17:5683474-5683496 CTGGGGCCGTGGAGGGCAGGGGG + Intergenic
1143461617 17:7108034-7108056 CTGTGGCAGTGCAGGGAGCCTGG - Intronic
1143462762 17:7114588-7114610 CTGAGGCTGGGGAGGCAACTGGG - Intronic
1144190183 17:12838556-12838578 CGGTGGCAGTGGAGGGAATCAGG + Intronic
1144526462 17:15994545-15994567 CTAAAGCTGTGGAGGGAACTGGG - Intronic
1144867616 17:18347010-18347032 CTGTGGCTGTGGATGGTGCCGGG + Intronic
1145272555 17:21412606-21412628 CTGAGGCTGTGCTGGGAAGGGGG - Intronic
1145310766 17:21700069-21700091 CTGAGGCTGTGCTGGGAAAGGGG - Intronic
1145712270 17:26988623-26988645 CGGAGCCTGTGGAGGGAGCGCGG + Intergenic
1145761325 17:27426769-27426791 CTGTGGCTGGGGAGGCAGCCTGG - Intergenic
1145822581 17:27850899-27850921 AACTGGCTGTGGTGGGAACGGGG + Intronic
1146275727 17:31514430-31514452 ATGTGGCTGTAGGGGGAAGGTGG + Intronic
1147160346 17:38566006-38566028 CTGTGGCAGTGTGGGGAACCAGG + Intronic
1147626226 17:41901975-41901997 ATGTTGCTGAGGTGGGAACGTGG + Intronic
1147788123 17:42995050-42995072 CTGTGTTTGTTGAGGGCACGGGG - Intergenic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148645816 17:49219297-49219319 CTGTGGCTGTGCAGAGGAAGTGG + Intronic
1149544897 17:57496259-57496281 CTGTGGCTCTGTAGGGCACACGG - Intronic
1149667622 17:58376789-58376811 GTGTGGCTGTGGAGGGCTCATGG + Intronic
1149982843 17:61325094-61325116 ATTTGGCAGTGGAGGGAGCGGGG - Intronic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1151266077 17:72956108-72956130 ATGTGGCATTGGAGGGATCGTGG - Intronic
1151419657 17:73988792-73988814 CTATGACTGTGGAGAGAACAGGG + Intergenic
1151747269 17:76018300-76018322 CTGGGGCTGGGGAGGGAGAGAGG - Intronic
1151915597 17:77115562-77115584 CTGTGGCTGTGAAGGGGTGGAGG + Intronic
1152016728 17:77755900-77755922 CTGTGGCTCTGGTGGGGACAGGG - Intergenic
1152036103 17:77874179-77874201 ATGTGGCTGGGGAGGGATGGGGG - Intergenic
1152111112 17:78358295-78358317 CTGTAGCTCTGGGGGGAAAGAGG - Exonic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152517705 17:80835880-80835902 CTGTGGCTGTGCTGAGAGCGAGG + Intronic
1152554665 17:81046888-81046910 CTGTGGCTGTGGTGGCACAGCGG + Intronic
1152574704 17:81134865-81134887 CTGGGGCTGGGAAGGGAACATGG + Intronic
1152660037 17:81537794-81537816 CTGTGGCTGGGGCGGGACTGGGG + Intergenic
1152660067 17:81537945-81537967 CTGTGGATGTGGACGGAAGTGGG - Intergenic
1152736932 17:82001610-82001632 CTGGGGCTGTGGGGAGAACTGGG + Intronic
1152800636 17:82329206-82329228 CTGTGGCTGTGCAGGGCCCAGGG - Intronic
1152922619 17:83073505-83073527 CTCTGGCTGTGGAGCGTGCGTGG - Intergenic
1153376982 18:4391854-4391876 GTGTAGATGTGGAGGGAATGAGG - Intronic
1156551470 18:38023627-38023649 CTGAGGCTGTGGTGGGAGTGGGG - Intergenic
1157158164 18:45287826-45287848 CAGCGGCTGTGGATGAAACGTGG + Intronic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157528716 18:48404923-48404945 CTGTGGCTGTGGGTGGCACCTGG - Intronic
1157565783 18:48678392-48678414 AGGTGGCTGGGGAGGGAAAGGGG - Intronic
1158435795 18:57435226-57435248 CAGTGGCTGTGGAGGGGGCGGGG - Intergenic
1158847596 18:61461409-61461431 TAGTGGCTGTGGAGGGAGCATGG - Intronic
1158888302 18:61849473-61849495 GTGTGGCTGTTGGGGGAAAGAGG - Intronic
1160200170 18:76789162-76789184 GCGTGGCTGGGGAGGGAACACGG - Intergenic
1160385290 18:78493056-78493078 CTGTGGCTGAGGAGGGCACGGGG + Intergenic
1160433950 18:78831967-78831989 CAGTGGCTGAGAAGGGAAGGAGG - Intergenic
1160686724 19:440204-440226 CCGGGGCTGGGGAGGGGACGGGG + Intronic
1160688751 19:450501-450523 ATGGGGCTGGGGAGGGGACGGGG - Intronic
1160831348 19:1106125-1106147 CTGTGGCTGTGGAGGCAGCCGGG + Intronic
1160881173 19:1321361-1321383 CCAGGGCTGGGGAGGGAACGGGG - Intergenic
1160967483 19:1753071-1753093 CTGGGGGTCTGTAGGGAACGGGG + Exonic
1161022379 19:2016106-2016128 CTGTTGCAGGGGAGGGGACGGGG + Intronic
1161040254 19:2106887-2106909 CAGGGGCTGGGGAGGCAACGGGG + Intronic
1161226682 19:3150206-3150228 CAGTGGCTGTGGAGGGATGCCGG + Exonic
1161236447 19:3200763-3200785 CTGGGGCTGGGGAGGGGACCAGG - Intronic
1161276203 19:3419067-3419089 CGGAGGCTGGGGAGGGGACGGGG + Intronic
1161529854 19:4781683-4781705 ATCTGGCTGGGGAGGGAAGGAGG - Intergenic
1161926154 19:7301679-7301701 CTGGGGCTGGGGAGGGGAGGTGG - Intergenic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162103497 19:8355058-8355080 CGGTGGCGGGGGAGGGCACGTGG - Intronic
1162136362 19:8557817-8557839 CTGGGCCTGGGGAGGGGACGGGG - Intronic
1162385667 19:10359239-10359261 GTGTGGCTGCGGAGGGAGCGGGG - Exonic
1163448293 19:17360604-17360626 CTGGGTCTGTGGAGGGAGAGAGG + Exonic
1163510620 19:17733134-17733156 CTGGGGCTGGGGAGGGGCCGAGG - Intronic
1163869687 19:19809700-19809722 CTGTGGCAGGGGAGGGCACCTGG - Intronic
1164755882 19:30689114-30689136 CTGAGGCTTTGGAAGGAAAGAGG + Intronic
1164756244 19:30691892-30691914 CTGTGGCAGTGGTGGGCACCCGG + Intronic
1165375271 19:35437435-35437457 CTGGGGCTATGGCAGGAACGAGG + Intergenic
1165706898 19:37982769-37982791 ATGTGGCTGTGGAGGGAGAGAGG + Intronic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1166712470 19:44945987-44946009 TTGTGGCTGTGGAGCGGAAGTGG + Exonic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167084249 19:47298301-47298323 CTGAGGCTGAGAAGGGAAGGTGG - Intronic
1167423051 19:49415026-49415048 CTGTGGGTGTGGAGTGGATGGGG - Intronic
1168302680 19:55415309-55415331 GTGTGGATGTGGAGGGTAGGAGG - Intergenic
1168393252 19:56027831-56027853 GTATGGCTGTGGAGGGAGTGTGG + Exonic
1168707655 19:58479121-58479143 ATGGGGCTGTGGAGGGAGCCTGG - Intronic
925166540 2:1719234-1719256 CTGTGGCTGAGGGGTGAAGGTGG - Intronic
925430051 2:3783683-3783705 GTGTGGCAGTGGAGGTAGCGTGG + Intronic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
925814633 2:7735669-7735691 CTGTGACTGGGGAGGGTACCAGG - Intergenic
925814719 2:7736463-7736485 CTGTGACTGGGGAGGGTACCAGG - Intergenic
925830009 2:7884479-7884501 CTGGGGGTGGGGAGGGAACTCGG + Intergenic
926252333 2:11162195-11162217 CTGTGTCTATGGAGGGAGCTGGG + Intronic
927170822 2:20367899-20367921 CTGTGGCTTTGCAGGGTACACGG + Intergenic
928780808 2:34818181-34818203 CTGTGGCAGGGGAGGGAGCAAGG - Intergenic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
929378419 2:41319207-41319229 TTGTGGTTGTGGATGGAAAGAGG - Intergenic
930724233 2:54667044-54667066 CTGTGGCTGCGGAGAGGACGAGG - Intronic
931092053 2:58896704-58896726 GTGTGGGTGTGGAGGGAAATGGG - Intergenic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
932811483 2:74830005-74830027 ATGTGGATGGGGAGGGAAAGAGG - Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
935412530 2:102780709-102780731 TTGTGGGTGTGGAGGGGATGTGG + Intronic
935656660 2:105429134-105429156 TTGTGGCAGTGGAGGGAGGGTGG - Intronic
936573105 2:113632784-113632806 GTGTGGCTGTGGAGTGAAAGGGG + Intronic
938014698 2:127857884-127857906 GTGGGGCTGGGGAGGGAACATGG - Intronic
938293556 2:130162953-130162975 CTGTCCCTGTGGAGGGCAGGAGG - Intronic
938462999 2:131510008-131510030 CTGTCCCTGTGGAGGGCAGGAGG + Intergenic
940694372 2:156959866-156959888 CTGAGCCTGTGGAGGGAGGGAGG + Intergenic
942372096 2:175296038-175296060 CTGAGGCTGCAGAGGGAAAGGGG - Intergenic
944539610 2:200743167-200743189 CTGTGGCTGAGTTGGGAAAGCGG - Intergenic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
947305168 2:228737898-228737920 CTGTGGATGTGAAAGGAAGGTGG + Intergenic
947698920 2:232216463-232216485 ATGTGGCTTTGCAGGGAAAGGGG - Intronic
948796174 2:240402980-240403002 CGGTGGCTGTGGAGGGGTGGGGG + Intergenic
949064780 2:241983478-241983500 CTGTGGCTGTGGGAGGAGCCGGG + Intergenic
1168800261 20:640188-640210 CTGTGGCTGGGCAGGTGACGAGG - Intergenic
1169219017 20:3810489-3810511 CTGTGGGTGGGAAGGTAACGTGG - Intergenic
1169270516 20:4195698-4195720 CTGTGGCTGGGCAGGGTAGGGGG + Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1172186913 20:33036625-33036647 CTAGGGCTGTGGAGGGAGGGAGG + Intronic
1172392998 20:34578977-34578999 CTGAGGCTCTGAAGGGAAAGTGG - Intronic
1172790981 20:37505315-37505337 ATGTGGCTGTGGTGGGACCTGGG + Intronic
1172872555 20:38144773-38144795 CTGTGGCCGTGGAGTTCACGTGG - Intronic
1172895958 20:38300146-38300168 CTGTGCCTGAGGATGGAGCGTGG + Intronic
1173147459 20:40537083-40537105 CTGTCCCTGAGGAGGGAAAGGGG - Intergenic
1173227073 20:41168314-41168336 CCCTGGCTGTGGAGGGGAGGGGG - Intronic
1174837020 20:53866167-53866189 CTGTGGCTGGGGAGGAGAGGAGG - Intergenic
1175247444 20:57590415-57590437 CTCTGGCTCTGGAAGGAACATGG - Intergenic
1175267503 20:57711384-57711406 CTGTGCCTGTGCAGGGAGAGCGG - Intronic
1175295129 20:57903150-57903172 CGGAGGCTGTGGGGTGAACGAGG - Intergenic
1175408198 20:58748787-58748809 CTGTGGTTGGGGAGGGAGGGAGG - Intergenic
1175825644 20:61935097-61935119 CTGTGGCTCTGCAGGGATCACGG + Intronic
1176305843 21:5122752-5122774 CAGGAGCTGTGGAGGGCACGCGG + Intronic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178893580 21:36540961-36540983 CAGTGGCTGTGGAGGGGGAGAGG + Intronic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179585204 21:42370238-42370260 CTGTGGCTGAGAGGGGGACGTGG - Intergenic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1179807957 21:43852031-43852053 CTGTGACTGCGGAGGGAACTGGG - Intergenic
1179807982 21:43852153-43852175 CTGTGACTGAGGTGGGAACTGGG - Intergenic
1179808028 21:43852404-43852426 CTGTGACTGCGGAGGGAACTGGG - Intergenic
1179851214 21:44139279-44139301 CAGGAGCTGTGGAGGGCACGCGG - Intronic
1179880996 21:44293299-44293321 CTGGGGCTGTGGGGGGAGCGTGG + Intronic
1180081654 21:45490119-45490141 CAGGGGCTGTGGAGGGATGGAGG - Intronic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1180189575 21:46155970-46155992 CTGGGGCTGTGGAGGGCGAGAGG + Intergenic
1180816487 22:18792756-18792778 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
1181106122 22:20576711-20576733 GTGTGGCTGTGGTGGAAAGGAGG + Intronic
1181202674 22:21227088-21227110 CTGTGTGTGGGGAGGGCACGGGG - Intronic
1181472454 22:23149182-23149204 CTGTGGCTGTGCAGGGGTGGGGG + Intronic
1182074252 22:27484083-27484105 GTTTGGCTATGGAGGGAAGGAGG - Intergenic
1182435364 22:30326534-30326556 GTGGGGCAGGGGAGGGAACGGGG + Intronic
1183193227 22:36335321-36335343 ATGTGCCTGTGGAGGCAGCGTGG - Intronic
1183483601 22:38077820-38077842 CTTTTCCCGTGGAGGGAACGAGG - Intergenic
1183739401 22:39661780-39661802 CTGTGGATGTGGATGGAGTGAGG + Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184515617 22:44960264-44960286 AGGTAGCTGTGGAGGGAAGGGGG - Intronic
1184959466 22:47918563-47918585 CTGTGGGTGTGGAGGGAGTCTGG - Intergenic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185427080 22:50778090-50778112 GTGTGGCTGTGGAGTGAAAGGGG - Intronic
1203224239 22_KI270731v1_random:68325-68347 CTGTGTGTGGGGAGGGCACGGGG + Intergenic
1203266587 22_KI270734v1_random:18467-18489 CTGTGTGTGGGGAGGGCACGGGG - Intergenic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
950479857 3:13237538-13237560 CTGTGTCTGTGGGGGAACCGGGG - Intergenic
950522678 3:13505918-13505940 CAGGGGCTGGGGAGGGAAAGTGG + Exonic
952076244 3:29701439-29701461 CTGAGGCTGAGGAGGCACCGAGG - Intronic
952555557 3:34526039-34526061 CAGTGGCTGTGGAGGGAGAGAGG - Intergenic
952980121 3:38727536-38727558 CTGTGGCTCTGCAGGGATGGTGG + Intronic
953352055 3:42223096-42223118 GTGTGGCTGTTGAAGGAGCGGGG + Exonic
953937932 3:47062571-47062593 CTGAGTCTTTGGAGGGAAAGAGG - Intronic
954619313 3:51986588-51986610 CTATGCCTGAGGAGGGAAAGGGG - Exonic
954782793 3:53073298-53073320 CTGTGGGTGAGGAGAGAACCTGG + Intronic
954854082 3:53627597-53627619 CTGTGGCTGTGGATGGGTGGGGG + Intronic
954981238 3:54747408-54747430 CTATGGCTGTGGATGGGACATGG + Intronic
955753296 3:62203817-62203839 CTGTGGCGGTGGGGGGCACTTGG - Exonic
955799285 3:62669292-62669314 ATGGGGCTGTGGAGGAAAGGAGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
959950355 3:112174483-112174505 CTGTGGCAGTGGAGGGAGCGGGG + Intronic
960538148 3:118835487-118835509 CTTTTGCTATGGAGGGAAGGAGG - Intergenic
961109159 3:124268942-124268964 CTGTGGATGTGGAGGGCTCTCGG + Exonic
962982654 3:140504778-140504800 CTCTGGCTCTGGAGAGAAGGTGG - Intronic
963972693 3:151447020-151447042 GTGTGGATCTGAAGGGAACGTGG + Exonic
965520521 3:169664849-169664871 CAAAGGCTGTGGAGGGAAAGGGG + Intergenic
968186654 3:196637431-196637453 CTTGGGATGTGGAGGGAATGGGG + Intergenic
968331988 3:197878605-197878627 CAGTGGTTGTGGTGGGGACGTGG - Intronic
968555431 4:1244417-1244439 CTGAGGCTGGGGAAGGAACAGGG - Intronic
968603875 4:1522420-1522442 CTGTGGCTGTGACGGGACAGAGG - Intergenic
968699645 4:2048419-2048441 CTGTGGCTGGGCAGGGACCCTGG + Intergenic
968789905 4:2652460-2652482 CTGTGGCTGTGTAGGAAGCATGG + Intronic
969414163 4:7047986-7048008 CTGTGGGTGATGTGGGAACGTGG + Intronic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
972346876 4:38199742-38199764 CTCTGCGTGTGGTGGGAACGGGG - Intergenic
973773195 4:54225149-54225171 CTGTGGCTGGGAGGGGAAGGAGG - Intronic
974666496 4:64969236-64969258 CTGTGGCTTTGTAGGGTACAGGG + Intergenic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975163265 4:71147907-71147929 CTGTGACTCTAGAGGGAACTGGG + Intergenic
975720885 4:77247663-77247685 CTGTGGCTGTAGTGGGATCTTGG + Intronic
977682134 4:99808490-99808512 CTGTGGAAGTGGAGGGGAAGAGG + Intergenic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
980309660 4:131109657-131109679 TAGTGGCTGTGGAGGGTAGGGGG + Intergenic
980325016 4:131332602-131332624 GTGTGTCTGTGGTGGGGACGGGG + Intergenic
980892167 4:138827569-138827591 CTGTGTCTGTGGAGGGGCCTGGG - Intergenic
981691644 4:147515359-147515381 CTGTGGTGGTGGGGGGAAGGGGG + Intronic
981719013 4:147780217-147780239 CTGTGGCTGTGGGTGGATCTGGG + Intronic
982737292 4:159019721-159019743 GTGTGGCTGTGGCAGGAACAAGG + Intronic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
986293966 5:6422244-6422266 CTGGAGCTTTGGAGGGAGCGTGG + Intergenic
988067846 5:26245152-26245174 CTGGGGCTGTGGATGGAAACTGG - Intergenic
990162334 5:52956132-52956154 CTGTGGCCTTGGAGAGAACATGG - Exonic
991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG + Intronic
992103826 5:73433755-73433777 CTGTTTCTGTTGAGGGAAGGAGG + Intergenic
992897121 5:81254930-81254952 CTGTGGCTGTGGCAGGACCATGG + Intronic
995048083 5:107672002-107672024 CTGTGCCTAAGGAGGGAAAGAGG - Intergenic
995600571 5:113791054-113791076 CTGTGCCTGTGGGTGGAATGGGG + Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
997554363 5:134782619-134782641 CTGAGCCTGGGGTGGGAACGGGG - Intronic
997601242 5:135139990-135140012 CAGAGGCTGTGGATGGAAAGTGG + Intronic
997625289 5:135327080-135327102 CTGAGGCTGTGGGCGGCACGGGG + Intronic
997952098 5:138250369-138250391 CTGGGGCTGTGCAGGCTACGGGG + Intergenic
997976776 5:138445666-138445688 CAGTGGCTGTGGAAAGAAGGAGG - Exonic
998146691 5:139733329-139733351 CTGAGGCAGCGGAGGGAAGGGGG - Intergenic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999229538 5:150053517-150053539 GTGAGGCTGTGGAGTGAAGGCGG + Exonic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1001055934 5:168449925-168449947 CTGCGGCTGTGGAGGGGCCTTGG - Intronic
1002192045 5:177483462-177483484 CTGTGGTGGTGGAGGGAGTGGGG + Exonic
1002285819 5:178162067-178162089 CTAGGGGTGAGGAGGGAACGAGG + Intergenic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004720465 6:18264279-18264301 CTGGGGCGGGGGAGGGGACGTGG - Intronic
1006181294 6:32154821-32154843 CTGTGGCAGGGGAGGGAGAGCGG + Intronic
1006459575 6:34150606-34150628 CTGAGGCTGGGGAAGGAAAGAGG - Intronic
1006923725 6:37642740-37642762 CTGTGGCAGTGGAAGGACAGGGG - Intronic
1006986313 6:38178023-38178045 CTGTGGCTCTGCAAGGAACTGGG + Intronic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1007599490 6:43072942-43072964 CTGTGGCTGTGGAGTGGTCCGGG + Exonic
1007713477 6:43839238-43839260 CAGGGGCTGTGCTGGGAACGGGG + Intergenic
1008308622 6:49937025-49937047 ATGTGGCACTGGAGGGAATGAGG + Intergenic
1009985779 6:70779526-70779548 CAGGGGCTGTGGTGGGAATGTGG + Intronic
1014218560 6:118777093-118777115 CTGGGGCTGGGGAGGGCATGGGG + Intergenic
1015591880 6:134830069-134830091 CTGTGGCTGTGGCTGGAACATGG - Intergenic
1015882118 6:137880130-137880152 CCGTGCCTGGGGAGGGAATGCGG + Exonic
1016894150 6:149036173-149036195 CCCTGGCTGTGGAGGGAACTGGG + Intronic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1018841152 6:167518092-167518114 CTGAGGCTGTGGGAGGAACTAGG - Intergenic
1018882090 6:167894166-167894188 CAGTGGCTGTGGAGGGATGCTGG + Intronic
1019314257 7:377246-377268 CTGGGGCAGTGGATGGAAGGGGG + Intergenic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019637926 7:2086322-2086344 TTGTGGCTGTGGTGTGAGCGAGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019911367 7:4102294-4102316 ATTTGGCTGTGGTGGGCACGGGG + Intronic
1020140662 7:5609750-5609772 CTGTGGCCCTGGAGGAAATGGGG - Intergenic
1020899804 7:13990442-13990464 CTGTGGCTGTGGGGAGGAGGAGG + Intronic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1021788304 7:24174619-24174641 CTGGTGCTGTGAAGGGAAAGTGG + Intergenic
1023105445 7:36759432-36759454 TTGTAGCTGTGGAGGGAAAAGGG - Intergenic
1023538456 7:41238931-41238953 ATGTGGCTGTGCAGGGAAACAGG - Intergenic
1024453977 7:49581671-49581693 CTGTGGCTTTGGAATGAAGGTGG - Intergenic
1026828894 7:73599961-73599983 CTGGGGCTGGGGAGGGGAGGGGG - Intronic
1028855617 7:95589273-95589295 CTGTGGGGGTGGAGGTAACAAGG + Intronic
1029514176 7:101015755-101015777 CTGTGCCTGTGGGGGTGACGTGG + Intronic
1029707825 7:102285053-102285075 CTGTGGGGGTGGAGGGGGCGTGG - Intergenic
1032451873 7:132038439-132038461 CTGTGGCTGGGCAGGAAAAGTGG - Intergenic
1033512138 7:142069649-142069671 CTGGGGCTGTGGAGAGGACTTGG - Intronic
1033515219 7:142098581-142098603 CTGGGGCTGTGGAGAGGACTTGG - Intronic
1033547844 7:142418171-142418193 GTGTGGCTGTGCAGGAAAAGTGG + Intergenic
1033592853 7:142828165-142828187 CAGTGGCTGTGGAAAGAAAGAGG - Intergenic
1034192631 7:149223842-149223864 CTGGGGCTGTGGCGGGGCCGGGG - Exonic
1034415759 7:150963568-150963590 CTGGGGCTGGGGTGGGAATGGGG - Intronic
1034518180 7:151598287-151598309 CAGAGGCTGGGGAGGGAATGGGG + Intronic
1035309059 7:157953294-157953316 CTGTGTCTCTGGAGTGCACGAGG + Intronic
1035391690 7:158508592-158508614 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391703 7:158508649-158508671 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391715 7:158508706-158508728 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391727 7:158508763-158508785 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391739 7:158508820-158508842 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1035391752 7:158508877-158508899 CTGTGGGTGTCGGGGCAACGTGG + Intronic
1036217125 8:6889918-6889940 CTGAGACTGGGGAGGGGACGGGG - Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037751384 8:21684615-21684637 CAGTGGCTGGGGAGGGGACAAGG - Intergenic
1038642654 8:29340148-29340170 CTGTGGCACTGGGGGGAACCGGG + Exonic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1044944606 8:97378852-97378874 CTGTGGCTGGGGCAGGAATGAGG - Intergenic
1045791304 8:105987886-105987908 CTGAGGCTGTGTAGGGCACCAGG - Intergenic
1045864164 8:106845806-106845828 CTATGGCAGTGGAGGGTAGGGGG - Intergenic
1048575247 8:135685032-135685054 CAGTGGCTGTGGAGAGAACCGGG - Intergenic
1048898198 8:139013652-139013674 CTGGGGCTATGAAGGGAACCTGG + Intergenic
1048971953 8:139650101-139650123 CTGTGGCTGTGGGAAGAACTTGG + Intronic
1049099401 8:140568427-140568449 CTGCTGCTGAGGAGGGAGCGAGG + Intronic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049354816 8:142182438-142182460 CTGTGGCTGTGGACGGTGAGAGG + Intergenic
1049779942 8:144424334-144424356 CTGTGGCTGAGGAGGGGTTGGGG - Intronic
1051726185 9:20089692-20089714 CTGTGGCAGTGGTGGGCAGGGGG - Intergenic
1053136016 9:35650638-35650660 CTGTGGATGTGAAAGGAAGGGGG + Intronic
1053292239 9:36888845-36888867 ATTTGGCTCTGGAGGCAACGGGG - Intronic
1053728822 9:41031572-41031594 CTGTTGGGGTGGAGGGAACATGG + Intergenic
1054699688 9:68400511-68400533 CTGTTGGGGTGGAGGGAACATGG - Intronic
1055712041 9:79073916-79073938 CTGTGGATGTGAAGGGACAGGGG + Intergenic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056761873 9:89421169-89421191 CTGTGGCTGTGGACGGGGAGAGG + Intronic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1059459445 9:114420601-114420623 CTGTGCATGTGGAGGGTACCTGG + Intronic
1060206755 9:121686819-121686841 CTGGGGCTCTGGAGGAAATGTGG - Intronic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060495237 9:124113473-124113495 CTGTGGCTGCAGAGGGAGCTAGG + Intergenic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1060937938 9:127526812-127526834 CTGTGGCTGTCGAGGGTGGGAGG + Intronic
1061033655 9:128101684-128101706 CTGTGCGTGTGGAGGGGGCGGGG + Intronic
1061073873 9:128328843-128328865 CTGTCGCTGTGGAGGGGAGGGGG + Intronic
1061728077 9:132592216-132592238 CTGTCGCTGTGGGGGGAGTGGGG - Intergenic
1062176208 9:135164447-135164469 CTCTGCCTGTGGAGGGAGGGGGG - Intergenic
1062315427 9:135964845-135964867 CTGTGGCTCCAGAGGGAGCGTGG - Intergenic
1062665950 9:137671904-137671926 ATGTGGCTGTGGAGAGGCCGTGG + Intronic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1187500181 X:19832908-19832930 CAGTGACTGTGGAGGGAACCAGG - Intronic
1189260884 X:39678130-39678152 CTGGGGCTGTGCAGGGGATGGGG + Intergenic
1190464808 X:50715697-50715719 GTGAGGCTGTGGAGGAAAGGTGG + Intronic
1192117439 X:68424818-68424840 CTGTGGCTGCTGTGGGAACTAGG - Intronic
1196794797 X:119493542-119493564 CTGTGGGTGGCGAGGGAACAGGG - Intergenic
1198525076 X:137492646-137492668 CAATGGCTGTGGAAGGAAGGGGG + Intergenic
1199336946 X:146629437-146629459 CTGTGGCAGTGTAGGAAACATGG + Intergenic
1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG + Intergenic
1200067647 X:153511873-153511895 GAGTGGCTGTGGAGGGCACAGGG + Intergenic