ID: 985645225

View in Genome Browser
Species Human (GRCh38)
Location 5:1081808-1081830
Sequence GGCACCTGCCGGGGAGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 926
Summary {0: 1, 1: 0, 2: 8, 3: 72, 4: 845}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985645225_985645239 -1 Left 985645225 5:1081808-1081830 CCGCCCACTCCCCGGCAGGTGCC 0: 1
1: 0
2: 8
3: 72
4: 845
Right 985645239 5:1081830-1081852 CACTGGTGGCCGGAGGGGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 328
985645225_985645235 -7 Left 985645225 5:1081808-1081830 CCGCCCACTCCCCGGCAGGTGCC 0: 1
1: 0
2: 8
3: 72
4: 845
Right 985645235 5:1081824-1081846 AGGTGCCACTGGTGGCCGGAGGG 0: 1
1: 0
2: 2
3: 15
4: 146
985645225_985645241 24 Left 985645225 5:1081808-1081830 CCGCCCACTCCCCGGCAGGTGCC 0: 1
1: 0
2: 8
3: 72
4: 845
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37
985645225_985645236 -6 Left 985645225 5:1081808-1081830 CCGCCCACTCCCCGGCAGGTGCC 0: 1
1: 0
2: 8
3: 72
4: 845
Right 985645236 5:1081825-1081847 GGTGCCACTGGTGGCCGGAGGGG 0: 1
1: 0
2: 1
3: 19
4: 311
985645225_985645234 -8 Left 985645225 5:1081808-1081830 CCGCCCACTCCCCGGCAGGTGCC 0: 1
1: 0
2: 8
3: 72
4: 845
Right 985645234 5:1081823-1081845 CAGGTGCCACTGGTGGCCGGAGG 0: 1
1: 0
2: 2
3: 20
4: 227
985645225_985645238 -2 Left 985645225 5:1081808-1081830 CCGCCCACTCCCCGGCAGGTGCC 0: 1
1: 0
2: 8
3: 72
4: 845
Right 985645238 5:1081829-1081851 CCACTGGTGGCCGGAGGGGAAGG 0: 1
1: 0
2: 4
3: 25
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985645225 Original CRISPR GGCACCTGCCGGGGAGTGGG CGG (reversed) Intronic
900149202 1:1170908-1170930 GGCACCTCTCGGGCAGTGGGTGG - Intergenic
900155863 1:1203066-1203088 CTCAGCTGCCGGGGAGTGGCGGG - Intergenic
900339703 1:2182234-2182256 GGGCCCTGCAGTGGAGTGGGGGG + Intronic
901024142 1:6270203-6270225 GGCAGCAGCCGGGCCGTGGGTGG - Intronic
901678700 1:10901211-10901233 GGCACACGCTGGGGAGTGGGGGG + Intergenic
902209594 1:14895127-14895149 GCCACCAGCCAGGTAGTGGGAGG - Intronic
902388943 1:16091642-16091664 GGCACCTCCCGGACAGTGAGGGG - Intergenic
902745937 1:18474412-18474434 GGCACCTGGCTGGGTCTGGGGGG - Intergenic
902974744 1:20080700-20080722 GGCCCATGCAGGGGTGTGGGAGG + Intronic
903026024 1:20430520-20430542 GGCACCTCACCGGGGGTGGGTGG - Intergenic
903661908 1:24983614-24983636 GGCACTGGACGGGGAGTGGTGGG + Intergenic
904014048 1:27406812-27406834 AGTACCTGCCTGGGGGTGGGGGG - Exonic
904271614 1:29353995-29354017 GGCACCAGCTGGTGAGTGGCAGG + Intergenic
904317178 1:29673136-29673158 GGCAGCTCCCAGGTAGTGGGTGG - Intergenic
904363532 1:29994998-29995020 AGGGCCTGTCGGGGAGTGGGGGG - Intergenic
904512732 1:31026629-31026651 GGCACATGCCTTGCAGTGGGAGG + Intronic
904648635 1:31987553-31987575 GGCATCTGCCTGGCAGTTGGGGG - Intergenic
904816612 1:33207102-33207124 GGGGCCTGTTGGGGAGTGGGGGG - Intergenic
905362803 1:37431906-37431928 GGCACCTGCCTGTGTGTGTGTGG - Intergenic
905365546 1:37449205-37449227 CACAGCTGCCAGGGAGTGGGGGG + Intergenic
905918117 1:41699813-41699835 GGCCCCTACCGGGGTGTGGGAGG - Intronic
906297515 1:44658293-44658315 GGCACCTCCTGGGTAGAGGGGGG - Intronic
906770228 1:48476756-48476778 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
906834420 1:49067908-49067930 GGGGCCTGTCGGGGTGTGGGGGG - Intronic
906915528 1:50005038-50005060 CAGACCTGCCGGGGAATGGGAGG + Intronic
907249791 1:53130495-53130517 GGCAGTAGCGGGGGAGTGGGGGG - Intronic
909043801 1:70685868-70685890 AGCACCTGCTGAGGAGAGGGGGG + Intergenic
910274041 1:85429167-85429189 GGGGCCTGCTGGGGGGTGGGAGG - Intronic
910523749 1:88153740-88153762 GGGGCCTGTCGAGGAGTGGGGGG + Intergenic
911311812 1:96301892-96301914 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
911403469 1:97406554-97406576 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
911411913 1:97520627-97520649 GGGGCCTGTTGGGGAGTGGGGGG - Intronic
912625718 1:111203758-111203780 GGCACCTGGCCGAGGGTGGGTGG + Intronic
912676474 1:111686113-111686135 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
912864128 1:113241794-113241816 GGGGCCTGTCGGGGAGTGGGGGG + Intergenic
913399182 1:118409137-118409159 GGGGCCTGTCGGGGAATGGGGGG + Intergenic
915735362 1:158081110-158081132 TGCATCTGCGGGGGAGTGGGAGG - Intronic
915887802 1:159741574-159741596 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
917192957 1:172437573-172437595 GGGGCCTGCCGGGGGGTGGGGGG + Intronic
917268392 1:173246308-173246330 GGAACCTGTTGGGGAGTTGGGGG - Intergenic
917289525 1:173457955-173457977 TGGGCCTGCCGGGGGGTGGGGGG + Intergenic
917629220 1:176876633-176876655 TGAACCTGGCAGGGAGTGGGAGG + Exonic
918339020 1:183551998-183552020 GCCACCTGCAGGGGACTGTGTGG - Intronic
918913893 1:190609741-190609763 GGGACCTGCCTTGGAGTGGGGGG + Intergenic
919326316 1:196111249-196111271 GGGACCTGTTGGGGGGTGGGGGG + Intergenic
920101033 1:203517162-203517184 AGCAGCTGATGGGGAGTGGGAGG - Intergenic
920429231 1:205905448-205905470 GGGACCTGTCGGGGGGTGGGGGG + Intergenic
920449768 1:206051118-206051140 GACACCTGCCTGGGTGTGGGTGG - Intronic
920584238 1:207142071-207142093 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
921175269 1:212587934-212587956 GGCACCTGCTGGGGCGGCGGGGG + Intronic
921306691 1:213803950-213803972 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
921565201 1:216709054-216709076 GGGGCCTGCAGGAGAGTGGGGGG + Intronic
921755165 1:218846882-218846904 GGGACCTGTCGGGGGCTGGGGGG + Intergenic
922066774 1:222151662-222151684 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
922176750 1:223203011-223203033 GCCCCCTGCCTGGGAGAGGGAGG + Intergenic
922502944 1:226110266-226110288 GGGAACTGCCGGGGAGCCGGGGG - Intergenic
922784206 1:228275066-228275088 TGCACCTGGTGGGGAATGGGGGG + Intronic
923066402 1:230521326-230521348 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
923248405 1:232156407-232156429 GGGGCCTGCTGGGGAATGGGAGG + Intergenic
923776070 1:236979592-236979614 GGCAGCTGCGGAGGAGTGAGTGG + Intergenic
923840094 1:237661335-237661357 GGGGCCTGTCAGGGAGTGGGGGG + Intronic
1063013929 10:2055593-2055615 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1063036203 10:2289088-2289110 GGATCCTGCCAGGGAGTGTGAGG - Intergenic
1063581504 10:7312066-7312088 GGGGCCTGTCGTGGAGTGGGGGG + Intronic
1064034167 10:11901891-11901913 GGCAGCTGTCGGGGGATGGGGGG - Intergenic
1064865028 10:19869808-19869830 GGCAGTGGCGGGGGAGTGGGTGG - Intronic
1064978233 10:21140780-21140802 GGGGCCTGTCGGGGAGTGGAGGG + Intronic
1065525446 10:26615548-26615570 GGCAACTGTAGGGGAGTTGGGGG + Intergenic
1066221019 10:33336098-33336120 GGCACCTCCCAGGGAGTTTGTGG + Intronic
1066529069 10:36316392-36316414 GGCCTCTTCCTGGGAGTGGGTGG + Intergenic
1067266911 10:44754353-44754375 GGGACCTGTCAGGGGGTGGGGGG - Intergenic
1067423280 10:46178318-46178340 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1067832866 10:49620477-49620499 GACACCTGCCGGGGAGGGCAGGG - Exonic
1067848388 10:49740172-49740194 GGCATCTGCCTGGGGGCGGGGGG + Intronic
1068035836 10:51758848-51758870 GGGCCCTGTCGGGGGGTGGGGGG - Intronic
1068056935 10:52023068-52023090 AGGACCTGTCGGGGTGTGGGGGG - Intronic
1068576417 10:58688868-58688890 GGGGCCTGTTGGGGAGTGGGGGG + Intronic
1068847226 10:61691645-61691667 GGGGCCTGTTGGGGAGTGGGGGG - Intronic
1068903481 10:62297179-62297201 GGCACCAGCAGGAGAGTGGAGGG - Intergenic
1069077148 10:64050646-64050668 GGCACCTCTCGGCCAGTGGGTGG - Intergenic
1069093131 10:64226437-64226459 GGGGCCTACTGGGGAGTGGGGGG - Intergenic
1069227562 10:65962708-65962730 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
1069345913 10:67469598-67469620 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1069743778 10:70702125-70702147 GGCCCTGGCAGGGGAGTGGGAGG - Intronic
1069780589 10:70952996-70953018 CTCACCTGCAGGGCAGTGGGAGG + Intergenic
1070813602 10:79310538-79310560 GGCATGTTCCGGGGAGCGGGAGG - Intronic
1070895954 10:79983070-79983092 GGAACCTGCCAGGGGGCGGGAGG - Intergenic
1070962294 10:80507489-80507511 GGCCCCTGCCTGGGAGCAGGAGG + Intronic
1071040686 10:81306090-81306112 GGGACCTGTCGTGGGGTGGGGGG - Intergenic
1071163616 10:82779875-82779897 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
1071273004 10:84026197-84026219 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1071340722 10:84645542-84645564 GGGACCTGTCGGGGGGTGTGGGG - Intergenic
1071733963 10:88277316-88277338 GGTGCCTGCCGGGGAGGTGGGGG + Intronic
1073080008 10:100853808-100853830 AGCACCTGCCTGGGACAGGGAGG - Intergenic
1073714697 10:106091013-106091035 GGCACCTGTGGGGAGGTGGGGGG - Intergenic
1074048214 10:109858541-109858563 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1074224895 10:111475219-111475241 GGGACTGGCCGGGGGGTGGGCGG - Intergenic
1074730997 10:116375447-116375469 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
1075080703 10:119381749-119381771 TGCACCTGGCGGGGAGGGGAGGG - Intronic
1075683923 10:124350893-124350915 GGAACCTGCCGGGGAGGGTAGGG - Intergenic
1075745051 10:124721272-124721294 GGGACCTGCCAGGATGTGGGAGG - Intronic
1076027530 10:127128542-127128564 GGGGCCTGCTGGGGAGTGGGGGG - Intronic
1076148661 10:128145513-128145535 GGCACCTGTTGGGGAGTGATTGG + Intergenic
1076339323 10:129732306-129732328 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
1076373528 10:129969146-129969168 GACACCTGCCCCGGGGTGGGTGG - Intergenic
1076710633 10:132331967-132331989 TGCGCCTGCCCGGGAGGGGGCGG - Intergenic
1076904904 10:133356850-133356872 CCCACCTGCCTTGGAGTGGGGGG - Intronic
1077386634 11:2272268-2272290 AGCACCTGCCTGGGAGCTGGTGG + Intergenic
1077481884 11:2818793-2818815 GACACCTGTTGGGGAGTGTGTGG - Intronic
1077524550 11:3056691-3056713 GGCAGCTTCCGGGAGGTGGGCGG - Intronic
1078698305 11:13657232-13657254 GGGACCTGTTGGGGAGTGGGGGG + Intergenic
1078755886 11:14209413-14209435 GGGGCCTGTCGGGGTGTGGGGGG - Intronic
1079778098 11:24559963-24559985 GGGACCTGTCGGGGGGTGGCAGG + Intronic
1079820990 11:25127873-25127895 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1079959230 11:26902131-26902153 AGCACCTGCCAGGGGGTTGGGGG + Intergenic
1080613078 11:33921908-33921930 GGGGCCTGGCGGGGCGTGGGGGG + Intergenic
1080671798 11:34386200-34386222 GGCGCCTGTCGTGGGGTGGGGGG - Intergenic
1080747472 11:35121166-35121188 GGCACCTGCTGGGCAGAGGCTGG + Intergenic
1080919881 11:36698401-36698423 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1080977699 11:37362600-37362622 GGGGCCTGTCGGGGAGTGGAGGG + Intergenic
1081043050 11:38235460-38235482 GGGGCCTGTCGGGGAGTGGGAGG + Intergenic
1081199050 11:40194609-40194631 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1082056583 11:47822721-47822743 GGCACCTGTCGTGGGGTAGGGGG - Intronic
1082166401 11:48955594-48955616 CGCCCCTTCCGGGAAGTGGGGGG - Intergenic
1082723656 11:56709564-56709586 GGGACCTGTCAGGGAGTGGTGGG - Intergenic
1082912252 11:58390546-58390568 GGCACATGGCGGGGACTGGCAGG - Intergenic
1082939034 11:58684478-58684500 GTGGCCTGTCGGGGAGTGGGGGG + Intronic
1083679033 11:64342860-64342882 GGCAGGTGTAGGGGAGTGGGGGG + Intronic
1083721782 11:64607113-64607135 GGCCCCTGGCAGGGAGAGGGTGG + Exonic
1083771817 11:64871767-64871789 TGCACCTGGAGGGGAGAGGGAGG + Intronic
1084014931 11:66372519-66372541 TGAACCTGCCTGGGAGGGGGAGG - Intergenic
1084327123 11:68407078-68407100 GGCACCGACAAGGGAGTGGGTGG - Intronic
1084604691 11:70165632-70165654 GGCTCCTGCGGGGGTCTGGGTGG + Intronic
1084989019 11:72905590-72905612 GGGACCTGTCGGGGGGTGGGGGG - Intronic
1085614606 11:77986826-77986848 GGGGCCTGTTGGGGAGTGGGGGG + Intronic
1085703179 11:78763349-78763371 GGCCCCTGATGGGGAGTGGAGGG + Intronic
1086050338 11:82581641-82581663 GGGGCCTGCCGGGGGGTGGGAGG + Intergenic
1087435880 11:98116974-98116996 GGGGCCTGTCGGGGAGTTGGGGG - Intergenic
1087545021 11:99574057-99574079 TGGGCCTGTCGGGGAGTGGGGGG - Intronic
1087668364 11:101076305-101076327 GGGATCTGTCGGGGGGTGGGGGG + Intronic
1087854283 11:103072749-103072771 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1088077758 11:105873076-105873098 GGGGCCTGTCAGGGAGTGGGGGG - Intronic
1088153612 11:106777669-106777691 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1088370613 11:109084543-109084565 GGGGCCTGTTGGGGAGTGGGGGG - Intergenic
1088772810 11:113052852-113052874 GGGCCCTGTCGGGGGGTGGGTGG - Intronic
1088830913 11:113536109-113536131 GGGGCCTGCCGGGGTGTCGGGGG + Intergenic
1088870526 11:113886619-113886641 GGCACCTCCCTGAGAGTGGATGG + Intergenic
1089846971 11:121466273-121466295 GACACTGGCCTGGGAGTGGGTGG - Intronic
1090653068 11:128823974-128823996 GGGGCCTGGCGGGGGGTGGGAGG - Intergenic
1091161157 11:133422119-133422141 GGGGCCTGCCAGGGGGTGGGGGG - Intronic
1091219224 11:133920462-133920484 GGCACCTGCAGGGAGGTGGGGGG + Exonic
1091558260 12:1592581-1592603 ACCCCCTGCAGGGGAGTGGGTGG + Intronic
1091589402 12:1834501-1834523 GGCACCGGCCGGCGAGCGTGAGG + Exonic
1091660647 12:2380816-2380838 GGGCCCTGCTTGGGAGTGGGTGG + Intronic
1091715047 12:2770914-2770936 AGGGCCTGTCGGGGAGTGGGGGG + Intergenic
1092080590 12:5712888-5712910 GGCTCATGTCAGGGAGTGGGAGG + Intronic
1092532343 12:9354960-9354982 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
1092633545 12:10413780-10413802 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
1092799028 12:12144902-12144924 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1093127269 12:15345597-15345619 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1093597140 12:20975743-20975765 GGAGCCTGTTGGGGAGTGGGGGG - Intergenic
1093627503 12:21366388-21366410 CGGGCCTGCCGGGGGGTGGGCGG + Intronic
1094052388 12:26235453-26235475 GGGGACTGTCGGGGAGTGGGGGG - Intronic
1094107890 12:26833040-26833062 GAAACCTGCCGGGGAGGCGGCGG - Exonic
1094402241 12:30074543-30074565 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1094491594 12:30964092-30964114 GGCCCCAGCCCTGGAGTGGGAGG + Intronic
1095433957 12:42167128-42167150 GGGGCCTGTTGGGGAGTGGGGGG + Intronic
1095438977 12:42223864-42223886 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1095614299 12:44170283-44170305 GGGGCCTGCTGGGGGGTGGGGGG + Intronic
1095681938 12:44987350-44987372 GGGGCCTGTCGGGGAGTGGGGGG - Intergenic
1095864326 12:46955277-46955299 GGGACCTGTCAGGGGGTGGGGGG - Intergenic
1097527169 12:60751454-60751476 GGGGCCTGTCAGGGAGTGGGGGG + Intergenic
1098515205 12:71367834-71367856 GGGGCCTGTTGGGGAGTGGGGGG - Intronic
1098644831 12:72885658-72885680 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1098927292 12:76364489-76364511 GGGACCTGTCGGTGGGTGGGAGG + Intronic
1099470146 12:83038126-83038148 GGGACCTGCTGTGGGGTGGGGGG + Intronic
1099637022 12:85226682-85226704 GGGGCCTGCTGGGGGGTGGGGGG - Intronic
1099687642 12:85909824-85909846 GGGACCTGCCGGGGGGTGGGGGG + Intergenic
1099704975 12:86140497-86140519 GGGGCCTGTCGGGGGGTGGGAGG + Intronic
1099809466 12:87562195-87562217 GGGGCCTGTCAGGGAGTGGGGGG + Intergenic
1099862650 12:88239366-88239388 GGGACCTGTCGTGGGGTGGGGGG - Intergenic
1099892139 12:88602955-88602977 GGGGCCTGCAGGGGGGTGGGGGG - Intergenic
1099962255 12:89407958-89407980 GGGGCCTGTCAGGGAGTGGGAGG - Intergenic
1100045255 12:90372404-90372426 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1100399107 12:94212477-94212499 GGGGCCTGCCGGGGGGTGGGGGG - Intronic
1100554795 12:95682740-95682762 CGAACCAGCCTGGGAGTGGGAGG - Exonic
1101205808 12:102486228-102486250 GGCTACTGACGGGGAGTGGGAGG - Intergenic
1101320952 12:103672667-103672689 GGCACCTGGCAAGGACTGGGGGG - Intronic
1102029215 12:109730389-109730411 GGCACCTGCCTGGGGGGCGGGGG + Intronic
1102153658 12:110706668-110706690 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1102543355 12:113638053-113638075 GGCGGCCGGCGGGGAGTGGGGGG - Intergenic
1102585588 12:113920555-113920577 GGCACTTGGCAGGTAGTGGGAGG - Intronic
1102825797 12:115947062-115947084 GGTAGCTGCTGGGGGGTGGGGGG - Intergenic
1102877418 12:116458940-116458962 GGCACCAGCATGGGAGTCGGGGG - Intergenic
1102969491 12:117155260-117155282 GGCACCTGCCGGGGCGGCAGTGG + Intronic
1103244045 12:119440051-119440073 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1103721470 12:122977813-122977835 CTCAGCTGCCGGGGAGTGGAAGG - Intronic
1103724361 12:122990403-122990425 GGCACCTGGTGGGTAGAGGGAGG - Intronic
1104542093 12:129675362-129675384 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1104857827 12:131910140-131910162 GGCACCTGCCCGGGCGGAGGTGG - Intronic
1104910110 12:132236259-132236281 GGCGGCTGGCGGGGAGCGGGTGG + Intronic
1104953642 12:132453557-132453579 GGGTCCTGTCGGGGGGTGGGGGG + Intergenic
1105465473 13:20635713-20635735 GGGGCCTGTCGGGGAGTGGAAGG + Intronic
1105659523 13:22478172-22478194 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1106325803 13:28688252-28688274 GGGGCCTGCTGGGGGGTGGGAGG - Intergenic
1106327424 13:28707389-28707411 GGGGCCTGTCGTGGAGTGGGGGG + Intronic
1106665528 13:31847010-31847032 GCTCGCTGCCGGGGAGTGGGTGG + Intergenic
1106886591 13:34191706-34191728 GGGGCCTGTCAGGGAGTGGGGGG + Intergenic
1107159225 13:37206340-37206362 GGGACCTGTCGTGGGGTGGGGGG + Intergenic
1107424411 13:40278725-40278747 GGAGCCTGTCGGGGAGTGGGGGG + Intergenic
1108194551 13:47979476-47979498 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1108267987 13:48731218-48731240 GGCACCTGCTGGGGAGGAGATGG + Intergenic
1109162834 13:58997360-58997382 GGGGCCTGCTGGGGGGTGGGAGG - Intergenic
1109279609 13:60340930-60340952 GGGGCCTGTCGTGGAGTGGGGGG - Intergenic
1109429736 13:62216292-62216314 GGGGCCTGTCGGGGGGTGGGAGG - Intergenic
1109833610 13:67826363-67826385 GGGGCCTGCCGTGGGGTGGGGGG + Intergenic
1110067495 13:71127259-71127281 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1110156578 13:72323810-72323832 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1110199155 13:72828428-72828450 GGCGCCTGTCGGGGAGTGGGGGG - Intronic
1110899879 13:80809131-80809153 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1111323123 13:86656648-86656670 GTGACCTGTCGGGGGGTGGGGGG - Intergenic
1111503729 13:89159246-89159268 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1112268057 13:97943548-97943570 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1112302336 13:98241328-98241350 AGCACCTCCAGGGGAGTGTGGGG + Intronic
1112338861 13:98536705-98536727 GGCTCCTGCAGGGGACTAGGAGG - Intronic
1112498604 13:99925150-99925172 GGCACCTGGAGGGCTGTGGGTGG - Intergenic
1112937577 13:104820383-104820405 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1113158091 13:107348595-107348617 GGGGCCTGCCGGGGGGTGGGAGG - Intronic
1113158821 13:107355537-107355559 GGGACCTGGCGGGGGGTGAGTGG + Intronic
1113429522 13:110237382-110237404 GTCTCCTGGCGGGGGGTGGGGGG - Intronic
1113570067 13:111347186-111347208 GGGACCTGCTGGGTGGTGGGTGG + Intergenic
1113895129 13:113759343-113759365 GGCTCCTGCGGGGGAGCGTGGGG + Intronic
1114894804 14:26974294-26974316 GTGACCTGCCGGGGACTCGGGGG - Intergenic
1115056682 14:29136219-29136241 GGGGCCTGTCGGGGCGTGGGGGG + Intergenic
1115385424 14:32790770-32790792 GGGGTCTGCCAGGGAGTGGGGGG - Intronic
1115464734 14:33702698-33702720 GGAACCTGAAGGGGAGAGGGTGG + Intronic
1115889559 14:38011583-38011605 GGAACCTGCCGGGTGGTGTGGGG + Intronic
1115958687 14:38810350-38810372 GGGGCCTGTTGGGGAGTGGGGGG - Intergenic
1116227082 14:42166178-42166200 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1116499954 14:45608361-45608383 GGCACCTGTGTGGTAGTGGGAGG + Intergenic
1116689076 14:48081457-48081479 GGGGCCTGCCGGGGGGTGGGGGG + Intergenic
1117675632 14:58152248-58152270 GGCTACGGCCGGGGATTGGGCGG + Intronic
1118184326 14:63523113-63523135 AGCCCCTTCCGGGAAGTGGGGGG + Intronic
1118372810 14:65152204-65152226 GGGACCTGTCTGGGGGTGGGGGG + Intergenic
1118515543 14:66524649-66524671 GGGGCCTGTCGGGGTGTGGGGGG - Intronic
1118529665 14:66688903-66688925 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1118685397 14:68285664-68285686 GGTTTCTGCCAGGGAGTGGGCGG + Intronic
1118752928 14:68819607-68819629 AGCCCCTCCCTGGGAGTGGGCGG + Intergenic
1119161881 14:72459557-72459579 GGCTCCTCCCTGGGTGTGGGAGG + Intronic
1119261338 14:73239862-73239884 GGAACCTGCAGGGGAGTCGGGGG + Intronic
1119377165 14:74204062-74204084 GGCAGGTGGCGGGGAGGGGGTGG + Intergenic
1119385802 14:74257601-74257623 CGCCCCTGCCGGGGATTGGCCGG + Intronic
1119419821 14:74501862-74501884 GGCTCCTGCTGGGGTTTGGGTGG + Intronic
1119643477 14:76331118-76331140 GGCAGCTTCAGGGGAGAGGGAGG - Intronic
1119764662 14:77181050-77181072 GGCCCCTGCCTGGGAGGGAGAGG + Intronic
1120040540 14:79748035-79748057 GGGGCCTGTCGGGGAGGGGGAGG + Intronic
1120086737 14:80284196-80284218 GGGGCCTGTTGGGGAGTGGGGGG - Intronic
1120130639 14:80802529-80802551 GGGGCCTGTTGGGGAGTGGGGGG + Intronic
1120568288 14:86086238-86086260 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
1120717913 14:87859999-87860021 GGGACCTGTCAGGGGGTGGGGGG + Intronic
1120833735 14:89021725-89021747 GGGGCCTGTCGTGGAGTGGGGGG + Intergenic
1121016869 14:90554248-90554270 GACACCTGCCGCAGAGTGGGTGG - Intronic
1121347900 14:93149669-93149691 GCAACCTGCCGGGGTGAGGGTGG - Intergenic
1122120638 14:99551813-99551835 GGGGCTTGCTGGGGAGTGGGAGG - Intronic
1122443352 14:101749966-101749988 GGCAGCAGCCTGGTAGTGGGAGG - Intergenic
1122464258 14:101919609-101919631 GGAACCTGCCTGGGAGTTTGTGG + Intronic
1122658446 14:103278907-103278929 GGCACCTGGCGGGCACTGTGCGG + Intergenic
1122985704 14:105210708-105210730 GGCTCCTGGCGGGGCGCGGGGGG - Intronic
1123162926 14:106297243-106297265 AGAGCCTGTCGGGGAGTGGGGGG - Intergenic
1123439634 15:20281180-20281202 GCCACATGCGGGGGAGTGGCAGG - Intergenic
1123783127 15:23646058-23646080 GGCACCTGCGGGCCAGCGGGCGG + Exonic
1124215625 15:27805557-27805579 GGCAGCTGCCCGGGTGTTGGCGG + Intronic
1124432538 15:29619796-29619818 GGCACGTGGCCAGGAGTGGGAGG - Intergenic
1124673569 15:31663436-31663458 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
1124970717 15:34487514-34487536 GGCACCTGTTGTGGGGTGGGGGG + Intergenic
1125502161 15:40246545-40246567 GGCTCCTGTCGAGGAGAGGGTGG + Intronic
1125502536 15:40248478-40248500 AGGACCTGCCGGGGAGGTGGGGG - Intronic
1126066135 15:44827675-44827697 GGCCCCAGCAGGGGAGAGGGTGG + Intergenic
1126093701 15:45072889-45072911 GGCCCCAGCAGGGGAGAGGGTGG - Intronic
1126100783 15:45117073-45117095 CCACCCTGCCGGGGAGTGGGGGG - Exonic
1126541221 15:49826296-49826318 GGGGCCTGTCGAGGAGTGGGGGG - Intergenic
1126577208 15:50209047-50209069 GACACCTGCTGGAGTGTGGGAGG + Intronic
1126839702 15:52705344-52705366 GGGGCCTGTTGGGGAGTGGGGGG + Intronic
1126943464 15:53791626-53791648 GGTACCTGCCGGGTGGTGTGGGG - Intergenic
1127286467 15:57538014-57538036 GGCACCTGCCCTGGGGCGGGGGG - Intronic
1127886953 15:63209902-63209924 GGGGCCTGTTGGGGAGTGGGGGG - Intronic
1128499558 15:68218347-68218369 GGCAACTGCCAGCAAGTGGGGGG - Intronic
1128621404 15:69153572-69153594 AGGGCCTGTCGGGGAGTGGGGGG - Intergenic
1128878199 15:71219422-71219444 ATCACTTGCCGTGGAGTGGGTGG + Intronic
1129228701 15:74184636-74184658 TGCACCTGCCCGGGAATGGAAGG - Intronic
1130181073 15:81629057-81629079 GGGACCTCCTGGGGGGTGGGGGG + Intergenic
1130870615 15:87969024-87969046 GGTACCTGGCAGGGGGTGGGGGG - Intronic
1131060332 15:89400252-89400274 GGCTCGGGCCGGGGAGGGGGTGG + Intergenic
1131419049 15:92288179-92288201 GGCACCATCCCGGGAGTGGCAGG - Intergenic
1131818367 15:96246206-96246228 GGCACCTGCTGGCGAGCTGGGGG - Intergenic
1131908593 15:97171301-97171323 GGCACCTGTCGAGGGTTGGGAGG + Intergenic
1132279072 15:100596888-100596910 GGTACGTGGCAGGGAGTGGGCGG - Intronic
1132406238 15:101543140-101543162 GGCATGTGTCTGGGAGTGGGTGG + Intergenic
1132639476 16:971086-971108 GGGGCCTCCCGGGGTGTGGGTGG - Intronic
1132679045 16:1132272-1132294 GTCACCTGCGGAGGGGTGGGCGG - Intergenic
1132765466 16:1532196-1532218 GGAACCTGACGGGGCGTGCGGGG - Intronic
1132844523 16:1993689-1993711 GGCCCCTGCCCAGGTGTGGGTGG + Exonic
1132861364 16:2073353-2073375 GGCACCTGATGGGGCGTGGAGGG - Intronic
1132870594 16:2114126-2114148 GGCACCTGCCTGGGGGCTGGTGG + Intronic
1133408929 16:5551792-5551814 AGCACCTGTCGGGGGGTGGGGGG - Intergenic
1133905156 16:10015735-10015757 GGCAACTGCAGGGGACAGGGAGG + Intronic
1134521938 16:14922778-14922800 GGCACCTGCCTGGGGGCTGGTGG - Intronic
1134709607 16:16321429-16321451 GGCACCTGCCTGGGGGCTGGTGG - Intergenic
1134716821 16:16361458-16361480 GGCACCTGCCTGGGGGCTGGTGG - Intergenic
1134949995 16:18347216-18347238 GGCACCTGCCTGGGGGCTGGTGG + Intergenic
1134957931 16:18390701-18390723 GGCACCTGCCTGGGGGCTGGTGG + Intergenic
1135057120 16:19240772-19240794 GGCACCTGCAGGCCAGTGGTAGG + Intronic
1135461836 16:22651266-22651288 GGGGCCTGCCAGGGGGTGGGGGG - Intergenic
1135620358 16:23950310-23950332 AGCACCAGTTGGGGAGTGGGAGG - Intronic
1137729804 16:50681093-50681115 GGCACCTGCTGGGGGCAGGGTGG - Intronic
1138159224 16:54737536-54737558 GGCACCTCCCAGGGATAGGGTGG - Intergenic
1138164691 16:54790106-54790128 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
1138756368 16:59490946-59490968 GACTCCTGCAGGGGAGGGGGAGG - Intergenic
1138878590 16:60982379-60982401 GGGACCCGTCGGGGGGTGGGGGG + Intergenic
1138897301 16:61222223-61222245 GGGACCTGCCGTGGGGTGGGGGG + Intergenic
1138917398 16:61483045-61483067 GGGGCCTGTCGGGGAATGGGGGG + Intergenic
1139001704 16:62518826-62518848 GGAGCCTGTCGGGGACTGGGGGG - Intergenic
1139258245 16:65564124-65564146 GGGGCCTGCCGGGGGGTGGAGGG - Intergenic
1139280397 16:65765594-65765616 GGAGCCTGTCGGGGGGTGGGGGG - Intergenic
1140129555 16:72148359-72148381 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1140602691 16:76497682-76497704 GGGTCCTGTTGGGGAGTGGGGGG + Intronic
1142149140 16:88505097-88505119 GGCACCAGCTGGCGGGTGGGCGG + Intronic
1142228574 16:88888926-88888948 GGCACCTGCTGGGGCGTGGCCGG + Intronic
1142373212 16:89694352-89694374 CCCACCTCCCTGGGAGTGGGAGG - Intronic
1142509357 17:384811-384833 GGCGGCTGGCGGGGAGGGGGCGG + Intronic
1143829572 17:9640397-9640419 GGCACCTGTCGGGGGGTGGTGGG - Intronic
1144298647 17:13902706-13902728 CGCAGCTGCAGGGGAGTGGCTGG - Intergenic
1144686515 17:17229525-17229547 GGCAGCTGCCGGGGACTGGGAGG + Intronic
1144950658 17:18991904-18991926 GACTCCTGCCAGGGTGTGGGAGG + Intronic
1144996527 17:19273184-19273206 GGCTCCTGAAGGGGAGTAGGAGG - Intronic
1145752908 17:27367934-27367956 GGCACATGACGGGAAGAGGGCGG - Intergenic
1146059677 17:29597900-29597922 GGCACCTGATGGGGAGGTGGAGG + Intronic
1146469214 17:33110874-33110896 GCAGCCTGCAGGGGAGTGGGAGG - Intronic
1146654016 17:34624666-34624688 GCCACCAGCAGGGGATTGGGAGG + Intronic
1146654818 17:34628908-34628930 GGCAGCTGCCGGGGAGGGGTGGG + Intronic
1146930279 17:36771964-36771986 GGCCCAGGGCGGGGAGTGGGTGG + Intergenic
1147044487 17:37743144-37743166 GGCGCCTGCGGCCGAGTGGGAGG + Intronic
1147182311 17:38694056-38694078 GGAAGCTGCTGGAGAGTGGGAGG + Intergenic
1147260710 17:39208532-39208554 GGCACCTGCTGAGGAGTGCAAGG - Intergenic
1147313711 17:39608812-39608834 GTCACCTGTCTGGCAGTGGGAGG - Intronic
1147819472 17:43233091-43233113 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1147820564 17:43239239-43239261 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1147820776 17:43240504-43240526 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1147821586 17:43244973-43244995 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1147822680 17:43251131-43251153 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1147825197 17:43265927-43265949 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1147826038 17:43270662-43270684 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1147826317 17:43272439-43272461 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1147827205 17:43277291-43277313 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1147828317 17:43283447-43283469 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1147829427 17:43289611-43289633 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1147830518 17:43295746-43295768 GGGCCCTGACGGGGCGTGGGGGG + Intergenic
1148115497 17:45172519-45172541 AGAAGCTGCCAGGGAGTGGGGGG + Intergenic
1148118194 17:45190401-45190423 GGTACCTGTCGGGGAGGGGCTGG + Intergenic
1148698868 17:49576483-49576505 GCCACCCGCTGCGGAGTGGGTGG - Intronic
1148786796 17:50149627-50149649 CGCACCTCCCGGGGCTTGGGGGG + Exonic
1148972352 17:51494908-51494930 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
1148983128 17:51596514-51596536 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
1149495194 17:57113069-57113091 GGCACCTCCTGGGGAGGGGAAGG - Intronic
1150248728 17:63694412-63694434 GGCCCCTGCCTGGGAGAGGCAGG - Exonic
1150306708 17:64091727-64091749 GGCACCTGCTGGGCAGGGGAGGG + Intronic
1150338055 17:64344297-64344319 AGCTGCTGCCGTGGAGTGGGTGG - Intronic
1150428496 17:65096732-65096754 GGGGCCTGTTGGGGAGTGGGGGG + Intergenic
1150823784 17:68457305-68457327 GGCCCCTGCCAGGGAGGTGGGGG - Intronic
1151388868 17:73772250-73772272 GGCAGTTGCCAGGGTGTGGGAGG - Intergenic
1151963765 17:77420678-77420700 GGCTGCTGCAGGGGAGAGGGTGG - Intronic
1152042502 17:77913641-77913663 GGGACCTGTCAGGGGGTGGGGGG + Intergenic
1152276872 17:79363124-79363146 GGCTCCTGCAGGGGAGATGGAGG + Intronic
1152287740 17:79422404-79422426 GGCACCGGCCTGGGAGTGGAGGG - Intronic
1152800220 17:82327359-82327381 GTCACCTGGCGGGGGCTGGGAGG + Intronic
1153474865 18:5488403-5488425 GGGGCCTGTCGGGGACTGGGGGG + Intronic
1154950555 18:21205335-21205357 GGGGCCTGCCGTGGGGTGGGGGG + Intergenic
1155127657 18:22895236-22895258 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1155131047 18:22934667-22934689 GGGGCCTGCCGTGGGGTGGGGGG - Intronic
1155932404 18:31721175-31721197 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1156128702 18:33940537-33940559 GGGGCCTGTCGGGGAGTAGGAGG + Intronic
1156191467 18:34726086-34726108 AGAGCCTGTCGGGGAGTGGGGGG + Intronic
1156448729 18:37254458-37254480 GGCACCTGCGGTGGCGAGGGGGG - Intronic
1156754924 18:40512133-40512155 GGAACCTGTCTGGGGGTGGGAGG - Intergenic
1158029997 18:52951435-52951457 GGGACCTGTCGGGGGGTGGGAGG - Intronic
1158431747 18:57394763-57394785 GGGGCCTGTCGGGGAGTGGGGGG - Intergenic
1159467590 18:68804555-68804577 GGCAGCTACCAGGGAGTAGGAGG + Intronic
1159542037 18:69790255-69790277 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1159737884 18:72124860-72124882 GGGGCCTGCCGGGCGGTGGGGGG + Intergenic
1160236133 18:77087956-77087978 GGCGCCTGGAGGGGAGCGGGAGG + Intronic
1160330524 18:77987390-77987412 GGGGCCTGCTGGGGGGTGGGAGG + Intergenic
1160466194 18:79078813-79078835 GGGGCCTGTCGGGGTGTGGGGGG - Intronic
1160592196 18:79951160-79951182 GGCCCCTGCCTGGGACGGGGGGG + Intronic
1160726158 19:618693-618715 GACATCAGCCGGTGAGTGGGGGG - Exonic
1160782729 19:885004-885026 AGCACCTGCGGGGGAGGTGGGGG + Exonic
1160788370 19:912190-912212 GGGACTGACCGGGGAGTGGGGGG + Intronic
1161120327 19:2522123-2522145 TGCTCCTGGCAGGGAGTGGGTGG + Intronic
1161123017 19:2540526-2540548 GGCCCCTGCTCGGGGGTGGGTGG + Intronic
1161138113 19:2632676-2632698 TGCTCCTGGCAGGGAGTGGGTGG - Intronic
1161138752 19:2635958-2635980 TGCACCTGGCATGGAGTGGGTGG + Intronic
1161145784 19:2677375-2677397 TGCTCCTGGCGTGGAGTGGGTGG + Intronic
1161148511 19:2694410-2694432 TGCTCCTGGCGTGGAGTGGGTGG + Intronic
1161148605 19:2694833-2694855 TGCTCCTGGCGTGGAGTGGGTGG + Intronic
1161154709 19:2726670-2726692 TGCACCTGGCATGGAGTGGGTGG + Intronic
1161166399 19:2790157-2790179 TGCTCCTGGCGTGGAGTGGGTGG - Intronic
1161175883 19:2841877-2841899 GGCCCCGGGCGGGGCGTGGGGGG - Intronic
1161228974 19:3163043-3163065 GGCACCGGCGGGCGGGTGGGAGG + Exonic
1161286159 19:3469425-3469447 TGCTCCTGGCGTGGAGTGGGTGG + Intergenic
1161294856 19:3514447-3514469 TGCCCCTGGCGTGGAGTGGGTGG - Intronic
1161322468 19:3647528-3647550 TGCTCCTGGCAGGGAGTGGGTGG + Intronic
1161574501 19:5048178-5048200 GGCACCTCCCGGGCAGGGGCAGG - Intronic
1161735528 19:5990144-5990166 TGCTCCTGGCAGGGAGTGGGTGG + Intergenic
1161952898 19:7477528-7477550 AGCCCCTGCCTGTGAGTGGGAGG + Intronic
1162751076 19:12829865-12829887 GGGACCTGGCTTGGAGTGGGCGG + Exonic
1162795819 19:13087120-13087142 GGAACCTGCCTGGGAGAGGCAGG + Intronic
1162803225 19:13122514-13122536 TGCCCCTGCCGGGGGGGGGGGGG + Intronic
1163368250 19:16888158-16888180 AGCACCTGCCGAGGACCGGGGGG - Intergenic
1163380836 19:16967328-16967350 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1163578181 19:18122783-18122805 GGCAGATGCCGGGTTGTGGGGGG + Intronic
1163584424 19:18156158-18156180 GGGGCCTGGCGGGCAGTGGGCGG - Exonic
1164197546 19:22983844-22983866 AGGGCCTGTCGGGGAGTGGGAGG + Intronic
1164595961 19:29530694-29530716 GGCACCTGCTGGAGAGCGGGAGG + Intronic
1164653964 19:29907033-29907055 GGGGCCTGTCGGGCAGTGGGGGG + Intergenic
1165969873 19:39618641-39618663 GGGACCTGTCAGGGAGTGGTGGG - Intergenic
1166502920 19:43354375-43354397 GGCACCTGCTGGGGGCTGTGGGG - Exonic
1166580476 19:43894202-43894224 GGAGCCTGTCGGGGAGTTGGGGG - Intronic
1167569863 19:50280332-50280354 GGCAGCTGCCAGGGAACGGGCGG + Exonic
1167611586 19:50510441-50510463 GGCTCCTGCTGGGGGTTGGGAGG + Exonic
1167862034 19:52292967-52292989 GGGGCCTGTCGGGGGGTGGGGGG - Exonic
1168078155 19:53991726-53991748 GGCCCCTGCTCGGGAGTCGGGGG + Intergenic
1168148501 19:54432527-54432549 GGCAACTGCCTGGCTGTGGGGGG - Intronic
1168339457 19:55615000-55615022 GGCAGCGGGCGGGGCGTGGGCGG - Exonic
1168346667 19:55653188-55653210 GGGACGTGCCTGGGAGGGGGCGG + Intergenic
1168362854 19:55757212-55757234 GGGACCTGTCGGGGGGCGGGGGG + Intergenic
1168363811 19:55767210-55767232 GGGACCTGTCGGGGGGCGGGGGG + Intergenic
924962589 2:46943-46965 GGCACCTGCCCGGGGGAGGTGGG - Intergenic
925289496 2:2737889-2737911 GGCATCTGCAGGTTAGTGGGTGG + Intergenic
925325505 2:3018573-3018595 GGGGCTTGCCGGGGAGTGGGGGG - Intergenic
926319378 2:11738224-11738246 GGGGCCTGTTGGGGAGTGGGGGG + Intronic
926527439 2:13998753-13998775 GGGGCCTGTCGGGGAGTGGGGGG + Intergenic
926661279 2:15469826-15469848 GGGGCCTGCTGGGGGGTGGGGGG + Intronic
926851655 2:17204738-17204760 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
927183363 2:20464611-20464633 GGGGCCTGTCGGGGGGTGGGAGG + Intergenic
927450561 2:23205997-23206019 GGCACCTGCTGCTGTGTGGGTGG - Intergenic
927945593 2:27133391-27133413 GGCACCTGCCATGGAGAGAGGGG - Intronic
928318113 2:30261376-30261398 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
928426095 2:31179223-31179245 GGGACCTGTCAGGGGGTGGGGGG - Intronic
928493481 2:31807487-31807509 GGGGCCTGCCAGGGGGTGGGTGG + Intergenic
928736781 2:34300578-34300600 GGGACCTGTCAGGGGGTGGGGGG + Intergenic
928776343 2:34768412-34768434 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
929196653 2:39191775-39191797 GGCACCTGCCTCCAAGTGGGTGG + Intronic
929818966 2:45258354-45258376 GGCAACCACTGGGGAGTGGGTGG - Intergenic
930156412 2:48111730-48111752 GGCGCCGGCCGGGGAGGGAGGGG - Intergenic
930200733 2:48549873-48549895 GGAACCTGGCTGGGGGTGGGTGG + Intronic
930710326 2:54544928-54544950 GGGGCCTACTGGGGAGTGGGGGG - Intronic
930780550 2:55221257-55221279 GGCATCTTCCGGGGATGGGGTGG + Intronic
931100138 2:58989652-58989674 GGAACCTGTCAGGGAGTGTGGGG + Intergenic
931557631 2:63522185-63522207 ATCACCTGCCGGGGGGTGGGGGG - Intronic
932107251 2:68955426-68955448 AGCACCTGTTGGGGAGTGAGGGG - Intergenic
932167195 2:69519114-69519136 GGCGTCTGCTGTGGAGTGGGAGG + Exonic
932432284 2:71683203-71683225 GGAAGCTGTCGGGGAGCGGGAGG + Intronic
933035123 2:77386776-77386798 AGGGCCTGTCGGGGAGTGGGGGG + Intronic
933467756 2:82677080-82677102 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
933953468 2:87349633-87349655 TGCACCGGGCGGGGGGTGGGGGG + Intergenic
935891430 2:107683103-107683125 GGGGCCTGCCGTGGGGTGGGGGG - Intergenic
935962103 2:108435957-108435979 GGGGCCTGTCAGGGAGTGGGGGG + Intergenic
936224613 2:110636636-110636658 GGGGCCTGCCGTGGGGTGGGAGG + Intergenic
936850192 2:116886827-116886849 GGAGCCTGTCAGGGAGTGGGGGG + Intergenic
937814977 2:126241354-126241376 TGCATCTGCCGTGGAGTGGCTGG - Intergenic
937982248 2:127622610-127622632 GGCACCTGCCGGGGTTAGGCTGG - Intronic
939199067 2:139011495-139011517 AGCGCCTACCGGGGGGTGGGGGG + Intergenic
939491490 2:142882481-142882503 GGAGCCTGTCGTGGAGTGGGGGG - Intronic
939710930 2:145519287-145519309 GGGGCCTGTCTGGGAGTGGGAGG - Intergenic
939999629 2:148954032-148954054 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
940687595 2:156873125-156873147 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
940703323 2:157073591-157073613 GGGGCCTGTCAGGGAGTGGGGGG + Intergenic
940839423 2:158561930-158561952 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
940978223 2:159970941-159970963 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
941046303 2:160679468-160679490 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
941124135 2:161565838-161565860 GGGGCCTGCCGTGGGGTGGGGGG - Intronic
941876866 2:170442654-170442676 AGGACCTGTCGGGGAGTGGGGGG - Intronic
941951545 2:171161020-171161042 GGGACCTGCCAGGGGCTGGGGGG + Intronic
942566056 2:177265182-177265204 GGCGCCAGCCGGGGTGGGGGGGG + Intronic
942894432 2:181034516-181034538 GGGACCTACCGTGGGGTGGGGGG + Intronic
943086787 2:183322053-183322075 GGGGCCTGTCGGGGTGTGGGGGG - Intergenic
943087664 2:183332701-183332723 GGGTCCTGTCGGGGTGTGGGGGG + Intergenic
943500303 2:188680731-188680753 GGGGCCTGCCGTGGGGTGGGGGG - Intergenic
944195424 2:197048341-197048363 GGGGCCTGTCAGGGAGTGGGGGG - Intronic
944666478 2:201963365-201963387 GGGACCAGCCGAGGAGTGGTGGG - Intergenic
945006776 2:205417081-205417103 GGGGCCTGCCGGGGGGTGGGGGG - Intronic
945903775 2:215568038-215568060 GGGGCCTGTCGGGAAGTGGGGGG + Intergenic
945937820 2:215921103-215921125 GGGGCCTGTCGGGGAGTGTGGGG + Intergenic
946411592 2:219517800-219517822 GGAGCCTGCCGGGGTATGGGTGG + Intronic
946847583 2:223873131-223873153 GGGGCCTGTCGGGGAGTGGGGGG + Intronic
946921616 2:224585787-224585809 GTCACATGGTGGGGAGTGGGAGG + Intergenic
947489168 2:230579049-230579071 GGCTCCTGTCGGGGAGGGAGGGG + Intergenic
947650974 2:231786257-231786279 GGAACCAGGCGGGGAGGGGGTGG - Intronic
947709542 2:232304114-232304136 GGCATCTGCCAGGGGGTGTGAGG - Intronic
947986905 2:234456118-234456140 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
948274613 2:236698724-236698746 GCCTCCTGCCAGGGAGTTGGGGG + Intergenic
948350458 2:237335950-237335972 GGCACAGGATGGGGAGTGGGAGG + Intronic
948949011 2:241236850-241236872 GGCACCTGCTGGGTGCTGGGTGG + Intronic
948991644 2:241558790-241558812 GGCTCCTGCCGCGGCGTCGGGGG - Exonic
949038241 2:241829731-241829753 GGGACCTGTCGTGGGGTGGGGGG + Intergenic
1168882868 20:1223144-1223166 GGGGCCTGCTGGGGGGTGGGGGG + Intergenic
1169862280 20:10165381-10165403 GGAGCCTGTCGGGGGGTGGGGGG + Intergenic
1170574035 20:17649288-17649310 GGCACCTGCCGGGCAGGGCGGGG + Intronic
1170696016 20:18659742-18659764 GGGGCCTGTCAGGGAGTGGGGGG + Intronic
1171023094 20:21604220-21604242 GGGGCCTGTCGGGGAGTGAGGGG - Intergenic
1171223200 20:23420479-23420501 GGGCCCCGCCGGGGAGGGGGCGG - Intronic
1172170104 20:32925050-32925072 GACACCAGACAGGGAGTGGGTGG + Intronic
1172428619 20:34872857-34872879 GGCTGCGGCGGGGGAGTGGGAGG + Exonic
1172951534 20:38726053-38726075 GCCGCCTGGTGGGGAGTGGGGGG - Intronic
1173048799 20:39539071-39539093 AGGGCCTGTCGGGGAGTGGGGGG + Intergenic
1173331662 20:42080514-42080536 TGCAGGTGCTGGGGAGTGGGAGG - Exonic
1173580328 20:44142517-44142539 GGGAGCTGCCCGGGAGAGGGAGG - Intronic
1173822565 20:46028909-46028931 GGCCCCGCCCGGAGAGTGGGTGG + Intronic
1174166360 20:48586362-48586384 GGCTCCTGCCTGGTAGTGGTGGG - Intergenic
1174560105 20:51425068-51425090 GGCTCCTGGCTGGGGGTGGGGGG + Intronic
1175210213 20:57349271-57349293 GGCACCTTCCACGGTGTGGGAGG + Intergenic
1175330414 20:58159915-58159937 GGAACCTGCCGGTGAGGCGGTGG - Intronic
1175491189 20:59382074-59382096 GGCACCTGCCAGGAAGAGGCAGG - Intergenic
1175530337 20:59670590-59670612 GGCATCTGCCGGGGGTGGGGGGG + Intronic
1175931478 20:62495827-62495849 GGCACCTCCCGTGGAGCTGGCGG + Intergenic
1175970847 20:62686025-62686047 GGTACCCTCCGGGGACTGGGGGG + Intergenic
1176122315 20:63459570-63459592 GGCAACTGCCAGGGACAGGGTGG + Intronic
1176698122 21:10005994-10006016 GGGGCCTGCCAGGGGGTGGGGGG - Intergenic
1177296516 21:19183040-19183062 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1177442817 21:21149568-21149590 GGGCCCTGTCGGGGGGTGGGGGG - Intronic
1177509678 21:22069165-22069187 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1177672978 21:24257319-24257341 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1177861390 21:26458864-26458886 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1177949955 21:27522483-27522505 GGGGCCTTTCGGGGAGTGGGGGG + Intergenic
1178232686 21:30804847-30804869 AGGACCTGTCAGGGAGTGGGGGG + Intergenic
1178493617 21:33070078-33070100 GGAACCTGCGGGGCAGCGGGTGG - Intergenic
1179024888 21:37671624-37671646 GGCATCTGCCGGGGTGGGGCAGG + Intronic
1179713800 21:43277553-43277575 AGGGCCTGCCGGGGAGTGGCCGG - Intergenic
1179937875 21:44616525-44616547 GGCACCTGGCAGGGAGGAGGAGG - Intronic
1180049656 21:45325391-45325413 GGGACTTGCCGGGGTGTAGGTGG - Intergenic
1180085695 21:45507090-45507112 GCAACCTGCCGTGGACTGGGAGG + Intronic
1180187043 21:46145231-46145253 AGCACTTGCCGGGGTGAGGGCGG + Intronic
1181100131 22:20533312-20533334 GGCATCTGCAGGGAAGTGTGGGG + Intronic
1181126020 22:20702857-20702879 GGCAGCTGCAGGGCAGTGGGAGG + Intergenic
1181420063 22:22791830-22791852 GTCACCTGCTTGTGAGTGGGAGG + Intronic
1181585119 22:23848994-23849016 GCCTCCTGCGGGGGAGAGGGAGG - Intergenic
1181638973 22:24187078-24187100 GGCACCTGCAGGGGAAGGGAGGG - Intronic
1182076309 22:27497842-27497864 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1182623603 22:31630792-31630814 GCCACCTGCGGGTGAGTGAGCGG - Intronic
1183365181 22:37403185-37403207 TGCACCTGCCTGGGGGTGGGGGG - Intronic
1183522423 22:38303244-38303266 GGCACCTGCCCGGGGCAGGGAGG + Exonic
1183670741 22:39270900-39270922 CGCTGCTGCCGGGCAGTGGGGGG + Intergenic
1184022318 22:41829068-41829090 GGCACCTGGCAGGGAGAGGCCGG - Intergenic
1184242126 22:43216861-43216883 GACACCTGGCGGGGGGTGGGTGG - Intronic
1184387708 22:44185828-44185850 GGGTCCTTCCGGGAAGTGGGTGG - Exonic
1184419015 22:44368845-44368867 GTCAGCTGCAGGGGAGTCGGGGG + Intergenic
1185045237 22:48525373-48525395 GGCACCTGTCGGGGTGAGGGTGG - Intronic
1185230401 22:49677298-49677320 GGCACCTGGCAGGAAGGGGGAGG - Intergenic
1185255281 22:49828015-49828037 GGGACCGGGCTGGGAGTGGGGGG + Intergenic
1185272163 22:49934670-49934692 AGGTCCTGCAGGGGAGTGGGGGG + Intergenic
949304226 3:2621486-2621508 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
949728409 3:7077561-7077583 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
950041233 3:9920684-9920706 GACCCCTGCCGGAGAGTGGATGG - Intronic
950407030 3:12811108-12811130 GGCACACGGCGGGGGGTGGGGGG + Intronic
950490298 3:13300595-13300617 AGCCCCTGCTAGGGAGTGGGTGG - Intergenic
951080488 3:18445340-18445362 CGCGCCGGCCGGGGTGTGGGGGG + Intronic
951135050 3:19095704-19095726 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
952319241 3:32260162-32260184 ACCACCTGCCGGAGAGTGGATGG + Intronic
952649046 3:35700865-35700887 GGTACATGTCGGGCAGTGGGGGG + Intronic
952813452 3:37425507-37425529 GGGGCCTGTCGGGGGGTGGGAGG - Intronic
953115789 3:39990988-39991010 GGGGCCTGTCGGGGAGTGTGGGG + Intronic
953167087 3:40475175-40475197 GGCACCTTCCAGGGCGTAGGTGG + Intergenic
953901339 3:46845785-46845807 GGCACCGGCCCGGGAGGGGATGG + Intergenic
954429160 3:50460035-50460057 GGAACCTGCAGGGGTGTCGGGGG - Intronic
954712558 3:52512341-52512363 GCCACCTGCCGGGCAGTGGGGGG + Exonic
954836740 3:53476401-53476423 GGGGCCTGCCAGGGAGTGGGGGG - Intergenic
955106426 3:55902858-55902880 GGAGCCTGGCGGAGAGTGGGCGG + Intronic
955109276 3:55931591-55931613 GGGGCCTGTCGGGGTGTGGGGGG + Intronic
955241589 3:57182972-57182994 GGGACTTGCGGGGGAGCGGGGGG + Intergenic
956770571 3:72522600-72522622 GGCACCTGCTGAGGAGTGTCTGG + Intergenic
956836612 3:73100973-73100995 GGCACCTTGAGGGGAATGGGCGG - Intergenic
957965710 3:87320922-87320944 AGCAGCTGTCGTGGAGTGGGAGG - Intergenic
960125765 3:113996860-113996882 GGGGCCTGCTGGGGGGTGGGGGG + Intronic
960198906 3:114807426-114807448 AGCAGCTGCAGGGGAGGGGGAGG - Intronic
960745822 3:120887098-120887120 GGGGCCTGTCGGGGTGTGGGGGG + Intergenic
960782945 3:121340483-121340505 GGGGCCTGTCGGGGGGTGGGAGG - Intronic
960783348 3:121345161-121345183 GGGTCCTGTCAGGGAGTGGGGGG - Intronic
961812984 3:129532416-129532438 GGTACGGGCCGGGGGGTGGGCGG + Exonic
962038704 3:131682732-131682754 TGGACCTGCCTGGGACTGGGAGG - Intronic
962553529 3:136522721-136522743 GGGACCTGCCGTGGGGTGGGGGG - Intronic
962956678 3:140273200-140273222 GGAACCTGTCGGGGGGTGGGGGG + Intronic
963421534 3:145066468-145066490 GGGGCCTGTCGTGGAGTGGGGGG + Intergenic
964172825 3:153790932-153790954 GGGGCCTGCCAGGGGGTGGGGGG - Intergenic
964245710 3:154650207-154650229 GGGGCCTGCCGGGGGTTGGGGGG + Intergenic
964936269 3:162092348-162092370 GGGACCTGTTGGGGAGTGGGGGG - Intergenic
965001817 3:162963695-162963717 GGGGCCTGCCGTGGGGTGGGGGG + Intergenic
965022650 3:163253337-163253359 GGGGCCTGTCGGGTAGTGGGGGG + Intergenic
965073108 3:163941204-163941226 GGGGCCTGCCGTGGGGTGGGGGG - Intergenic
965256970 3:166425693-166425715 GGCTGCTGCCAGGGAATGGGAGG - Intergenic
965432522 3:168606948-168606970 GGGGCCTGTCGGGGTGTGGGGGG - Intergenic
965800663 3:172490622-172490644 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
965844727 3:172947767-172947789 GGGGCCTGTCGGGGAGTGAGGGG + Intronic
966557288 3:181276826-181276848 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
966559811 3:181307735-181307757 GGGGCCTGTTGGGGAGTGGGGGG + Intergenic
967138361 3:186531688-186531710 GGGGCCTGTCGTGGAGTGGGGGG - Intergenic
968250982 3:197213390-197213412 GGTACCTGGTGGGGAGTGGAGGG + Intronic
968262059 3:197333477-197333499 GGGACCTGTCGGGGTGTCGGGGG - Intergenic
968288835 3:197523726-197523748 GGAACCTGGCGGGAGGTGGGAGG + Intronic
968589482 4:1450300-1450322 TGCTCCTGCCGGGGACTTGGTGG - Intergenic
968809320 4:2792966-2792988 GGGACCCGCCGGGGAGGGGCGGG + Intergenic
968916476 4:3499088-3499110 GGCAGGTGCCGGGCAGCGGGTGG + Intronic
969209987 4:5679763-5679785 GGGACCTGTCGGGGGATGGGGGG - Intronic
969536394 4:7758586-7758608 GCCACCTACCGGGGAGAGAGGGG - Intergenic
969900027 4:10340545-10340567 GGGGCCTGTCGGGAAGTGGGAGG + Intergenic
971500963 4:27317562-27317584 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
972919396 4:43919656-43919678 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
973097578 4:46222365-46222387 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
973589358 4:52425064-52425086 GGGGCCTGCTGGGGAGTGGGGGG - Intergenic
974041944 4:56865007-56865029 TGCACCTGTCTGGGAGTGGCAGG - Intergenic
974323665 4:60386674-60386696 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
975184441 4:71384867-71384889 GGGACCTGTTGGGGAGTAGGGGG + Intronic
975408753 4:74023092-74023114 GGGGCCTGTCGGGGGGTGGGAGG + Intergenic
975436967 4:74364845-74364867 GTCACCTGCCCTGTAGTGGGTGG - Intergenic
975612201 4:76213964-76213986 GGGACCGGCCGGGGAGGGCGCGG - Intergenic
975950204 4:79761414-79761436 GGGGCCTGCTGGGGGGTGGGGGG - Intergenic
976348284 4:84030455-84030477 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
976371322 4:84291762-84291784 GGGGCCTGTCAGGGAGTGGGCGG + Intergenic
976938347 4:90667494-90667516 GGGGCCTGTCAGGGAGTGGGGGG - Intronic
976969215 4:91083400-91083422 GGAGCCTGCCGGGGGGTTGGCGG + Intronic
977896480 4:102371378-102371400 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
978007191 4:103631166-103631188 GGGGCCTGTCGGGGTGTGGGTGG + Intronic
978409983 4:108416007-108416029 GGCACCTTCCTGGGGGTGAGGGG + Intergenic
978838757 4:113184860-113184882 GGGGCCTGTTGGGGAGTGGGAGG - Intronic
979141117 4:117175719-117175741 GGGGCCTGTTGGGGAGTGGGGGG + Intergenic
979231640 4:118353570-118353592 GGCACCGGCTGGAAAGTGGGAGG - Intergenic
979944862 4:126816193-126816215 GGGGCCTGTTGGGGAGTGGGGGG + Intergenic
980832741 4:138151700-138151722 GGGGCCTGTCGGGGAGTAGGGGG - Intergenic
980984483 4:139682481-139682503 GGAGCCTGGCAGGGAGTGGGAGG + Intronic
981154922 4:141423699-141423721 GGCTCCTGTCGGGAGGTGGGGGG - Intergenic
981221649 4:142244063-142244085 GGGACCTGTCAGGGGGTGGGGGG - Intronic
981615177 4:146638171-146638193 GGCACCCGCCGGGCCGTGGGGGG + Intergenic
981921989 4:150095938-150095960 GGAACCTGCAGGGAAGTGGTGGG + Intronic
982269695 4:153573683-153573705 GGCACATTTCAGGGAGTGGGAGG + Intronic
982492204 4:156043494-156043516 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
982507110 4:156233332-156233354 GGGTCCTGCCAGGGGGTGGGGGG - Intergenic
982723189 4:158880430-158880452 GGGACCTGTGGTGGAGTGGGGGG + Intronic
982894161 4:160895699-160895721 GGGGCCCGTCGGGGAGTGGGAGG - Intergenic
983013650 4:162581499-162581521 GGAACCTGTCGTGGGGTGGGGGG + Intergenic
983135414 4:164073485-164073507 GGGGCCTGTCAGGGAGTGGGGGG + Intronic
983533290 4:168832634-168832656 GGCAGCTGGCGGGGAGAGGGTGG + Intronic
983904541 4:173169515-173169537 CCCGCCCGCCGGGGAGTGGGAGG + Intronic
983944516 4:173570292-173570314 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
984193425 4:176631100-176631122 GGGACCTGTCGGGAGGTGGGGGG + Intergenic
984455699 4:179965494-179965516 AGGGCCTGCCGGGGTGTGGGGGG - Intergenic
985542237 5:492412-492434 GGGACCTGCGGGGGAGGGGAGGG + Intronic
985638064 5:1049635-1049657 TGGACCTGCCGGGGAAGGGGCGG + Intergenic
985645225 5:1081808-1081830 GGCACCTGCCGGGGAGTGGGCGG - Intronic
985758474 5:1733067-1733089 GGCAGCTGGCTGGGGGTGGGGGG - Intergenic
985783501 5:1882563-1882585 GGCACCTGCGGTGGCCTGGGCGG + Intronic
986051056 5:4090700-4090722 GGGGCCTGTCGGGGAGTCGGGGG + Intergenic
986118877 5:4811533-4811555 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
987852378 5:23373210-23373232 GGGGCCTGTCGGGGAGTGGGGGG - Intergenic
987902945 5:24037376-24037398 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
988311973 5:29571156-29571178 GGGACCTGTCGGTGGGTGGGGGG - Intergenic
988388670 5:30599066-30599088 GGAACCTGTCGTGGGGTGGGGGG - Intergenic
988490783 5:31703465-31703487 GGGACCTGTCGGGGGGTCGGGGG + Intronic
988688156 5:33545850-33545872 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
989078112 5:37586561-37586583 GGGGCCTGCCGGTGGGTGGGGGG - Intronic
989079462 5:37602058-37602080 GGGGCCTGTCGGGGGGTGGGAGG + Intronic
989247183 5:39267273-39267295 GGCACATGCCGGGCACTGGATGG - Intronic
989274083 5:39566561-39566583 GGGGCCTGTCGGGGAGTGGGGGG - Intergenic
990351197 5:54918559-54918581 GGGGCCTGCGGGGGGGTGGGGGG + Intergenic
990382708 5:55232542-55232564 GTCACCTGCCGGGAAGGAGGGGG + Exonic
990536203 5:56725230-56725252 GGGACCTGTCGGTGAGTAGGGGG + Intergenic
991040591 5:62171267-62171289 GGGTCCTGTCGGGGGGTGGGGGG - Intergenic
991100251 5:62784078-62784100 GGCGCCTGTCGGGGGGTGGGGGG - Intergenic
991484947 5:67125404-67125426 GGGGCCTGTCGGGGAGTTGGGGG - Intronic
992025130 5:72662632-72662654 GGCAACTGTCCTGGAGTGGGTGG - Intergenic
992288469 5:75260303-75260325 GGCACCTGTTGGGGGGTTGGGGG + Intergenic
993249054 5:85492404-85492426 GGGACCTGTCGGGGGGTGCGGGG - Intergenic
993774166 5:91970497-91970519 GGGGCCTGCCGTGGGGTGGGGGG - Intergenic
993781825 5:92075849-92075871 GGGGCCTGCCGTGGGGTGGGGGG - Intergenic
994219529 5:97179801-97179823 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
994388840 5:99165388-99165410 GGGGCCTGCTGGGGGGTGGGGGG - Intergenic
995349569 5:111159580-111159602 GGGGCCTGTCGAGGAGTGGGGGG - Intergenic
995612668 5:113926539-113926561 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
996056426 5:118988210-118988232 GCCCCCTGCCGGGGAGTCGGCGG - Intronic
996097219 5:119411634-119411656 GGCACCGGGCGGGGGGTAGGGGG - Intergenic
996271368 5:121608430-121608452 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
996932329 5:128904776-128904798 GGGGCCTGTCGGGCAGTGGGGGG - Intronic
997089559 5:130841391-130841413 GGAGCCTGTTGGGGAGTGGGGGG - Intergenic
997815004 5:137008128-137008150 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
998008866 5:138676950-138676972 GGCCCCTCCTGGGCAGTGGGAGG + Intronic
998211080 5:140198958-140198980 GGGGCCTGTCGGGGAGTTGGGGG - Intronic
998365579 5:141628635-141628657 GTCACCTGTAGGGAAGTGGGTGG + Exonic
998934564 5:147220322-147220344 GGTGCCTGTCGGGGGGTGGGGGG + Intergenic
1000597693 5:163234728-163234750 GGGACCTGTCGGGGGGTGGAGGG - Intergenic
1000654095 5:163854924-163854946 GGGGCCTGTCGGGGAGTGTGGGG + Intergenic
1000781339 5:165485962-165485984 GGGACCTGTCGTGGGGTGGGGGG + Intergenic
1001167253 5:169380884-169380906 GGGGTCTGCCGGGGGGTGGGAGG + Intergenic
1001348285 5:170930562-170930584 AGGGCCTGCCGGGGAGTGGGGGG - Intronic
1001369074 5:171178172-171178194 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
1001448249 5:171804044-171804066 GGGGCCTGTCGGGGAATGGGGGG + Intergenic
1001669059 5:173458927-173458949 GGTAGTTGCCGGGGACTGGGAGG + Intergenic
1001678663 5:173539499-173539521 GGGGCCTGCCGGGGGGTGGGGGG + Intergenic
1001697766 5:173685077-173685099 GGCTCCTGCCGGTGGGTTGGTGG - Intergenic
1002315564 5:178341091-178341113 GGCACTGGACAGGGAGTGGGGGG - Intronic
1002794251 6:458039-458061 GGGACCTGTCAGGGGGTGGGGGG - Intergenic
1002936474 6:1677785-1677807 GGTACCTGTCGTGGGGTGGGGGG + Intronic
1002988614 6:2216841-2216863 GGCACCTGCCCAGGAGAGGCGGG - Intronic
1003174390 6:3744454-3744476 GCCTCCTGCCCGGGAGTGTGGGG - Intronic
1003241114 6:4346641-4346663 GGCTCCTGTCGGGGAATGTGGGG + Intergenic
1004720373 6:18263954-18263976 GGCCCCTGCTGCGGAGGGGGAGG - Exonic
1005128452 6:22474994-22475016 GGGACCTGTCGGGGGGTGGGGGG + Intergenic
1005813675 6:29533764-29533786 GGCATCTGCCTGAGAGTGGGAGG - Intergenic
1006076413 6:31535321-31535343 GGCAGCGGGCGGGGAGTGGAGGG + Intronic
1006237773 6:32650689-32650711 GGGGCCTGTCGGGGAGTCGGGGG + Intergenic
1006452153 6:34111579-34111601 GTCCCCTGCCGGGGTGTGGATGG - Intronic
1006616617 6:35332366-35332388 GGCAGCAGCCTGGCAGTGGGAGG + Intergenic
1006950671 6:37819431-37819453 GGCGCACGCCGGGGAGGGGGCGG + Intergenic
1008060655 6:46993210-46993232 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1008223307 6:48879688-48879710 GGTACCTGCCGGGAGGTGTGGGG + Intergenic
1008995547 6:57654095-57654117 GGGGCCTGTTGGGGAGTGGGGGG + Intergenic
1009027968 6:58022808-58022830 GGCACCTGCCGTGGGGTGGGGGG - Intergenic
1009203505 6:60774272-60774294 GGCACCTGCCGTGGGGTGGGGGG - Intergenic
1009331371 6:62424983-62425005 GGGGCCTGTCGGGGAGTAGGGGG + Intergenic
1009484130 6:64198478-64198500 GGGGCCTGTTGGGGAGTGGGGGG - Intronic
1011136857 6:84109753-84109775 AGGACCTGTCGGGGGGTGGGGGG - Intergenic
1011141659 6:84164685-84164707 GGTACCTGTCGGGGGGTGAGGGG + Intronic
1011831007 6:91371548-91371570 GGGGCCTGCCGGGGGGTGAGGGG - Intergenic
1012687826 6:102274713-102274735 GGGGCCTGTCGTGGAGTGGGGGG - Intergenic
1013310693 6:108890907-108890929 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
1013373886 6:109495714-109495736 GGCATCTGCCTGGGGGTGAGGGG - Intronic
1013535918 6:111062884-111062906 GGGGCCTGTCGGGGGGTGGGAGG - Intergenic
1013625107 6:111929156-111929178 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1014456595 6:121642067-121642089 GGCAGCTGAAGGGGACTGGGAGG + Intergenic
1014754197 6:125285153-125285175 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1014902819 6:126988494-126988516 GGGGCCTGTCCGGGAGTGGGGGG + Intergenic
1014959183 6:127660930-127660952 AGGACCTGTCGGGGCGTGGGGGG + Intergenic
1015045739 6:128774280-128774302 GGGGCCTGTCGGGGAGTGGGGGG - Intergenic
1015393541 6:132710524-132710546 GGGGCCTGTCGGGGAGTCGGGGG - Intronic
1015521555 6:134136525-134136547 GGGGCCTGCTGTGGAGTGGGGGG - Intergenic
1016313860 6:142764357-142764379 GGCACCCACCTGGGAGTGTGTGG + Intronic
1016433303 6:144009670-144009692 GGGGCCTGTTGGGGAGTGGGGGG - Intronic
1016641161 6:146351173-146351195 GGCAGCTGGCAGGGAGTGTGAGG + Intronic
1017151888 6:151288053-151288075 GGGGCCTGTTGGGGAGTGGGGGG + Intronic
1017285774 6:152674767-152674789 GGGGCCTGTCGGGGACTGGGGGG - Intergenic
1017699551 6:157055050-157055072 GGCATCAGCCGGGAAGTAGGGGG + Intronic
1018091511 6:160349566-160349588 GGCTGCTGCCGGCGGGTGGGCGG + Intronic
1018393229 6:163356634-163356656 GGCACCGGGCGGGGAGCAGGAGG - Intergenic
1019050813 6:169181974-169181996 GGGGCCTGTCGTGGAGTGGGGGG + Intergenic
1019430454 7:996637-996659 GGCAGCTGCCGGGGAGGGCCGGG - Intergenic
1019714082 7:2530399-2530421 GTCACCTTCTGGGGGGTGGGGGG - Intergenic
1019779378 7:2930500-2930522 GGCTCCTGGCGGGGAGGGGGTGG + Intronic
1020119571 7:5495538-5495560 GGCTCCTGGCAGGGAGGGGGTGG - Intronic
1020431324 7:8119131-8119153 GTCAGCTGCCTGGGAGTGTGGGG - Intronic
1020933241 7:14427084-14427106 GGGGCCTGTCAGGGAGTGGGGGG + Intronic
1021169964 7:17387259-17387281 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1021378435 7:19937354-19937376 GGGACCTGTTGGGGGGTGGGGGG - Intergenic
1022221974 7:28322598-28322620 AGAGCCTGTCGGGGAGTGGGGGG - Intronic
1022435548 7:30380836-30380858 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
1023031000 7:36090318-36090340 GGGAGCTGGCGGGGGGTGGGTGG - Intergenic
1023224484 7:37954581-37954603 GGGGCCTGCCAGGGGGTGGGGGG + Intronic
1023273161 7:38488509-38488531 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1024036415 7:45510792-45510814 CGCTCCTGCCTCGGAGTGGGAGG + Intergenic
1024041162 7:45556359-45556381 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1024045441 7:45582560-45582582 GGCACCTGGCGGGGGGTGGGGGG + Intronic
1024105831 7:46085533-46085555 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1025211745 7:57023232-57023254 GGGACCTGCGTGGGGGTGGGGGG - Intergenic
1025660210 7:63553594-63553616 GGGACCTGCGTGGGGGTGGGGGG + Intergenic
1027374519 7:77537126-77537148 GGCTGCTGGCGGGGGGTGGGGGG + Intergenic
1027923768 7:84433228-84433250 GGGGCCTGTCGGGGGGTGGGAGG - Intronic
1028083092 7:86601110-86601132 GGCAGCTGATAGGGAGTGGGAGG - Intergenic
1028601768 7:92608806-92608828 GGCACCGGCAGGTGAGTGGGAGG + Exonic
1028740601 7:94269882-94269904 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1029018154 7:97336038-97336060 GGAGCCTGTCGGGGGGTGGGGGG + Intergenic
1029110530 7:98211312-98211334 GGCACCTGCGGGCGGGCGGGCGG - Intergenic
1030612023 7:111700097-111700119 GGATCCTGTCGGGGGGTGGGGGG - Intergenic
1030730023 7:112976430-112976452 GGGACCTGTCGGGGGGTTGGGGG + Intergenic
1030871733 7:114764404-114764426 GGGACCTGTCGGGGGGTGGGGGG + Intergenic
1030897224 7:115075885-115075907 GGAGCCTGTCGGGGGGTGGGGGG - Intergenic
1030954049 7:115828853-115828875 GGCATCTGAAGGGGAGGGGGAGG + Intergenic
1031980701 7:128122506-128122528 GGAGCCGGCCGGGGGGTGGGGGG - Intergenic
1032023281 7:128421816-128421838 GGCACCTGAGCGGGGGTGGGGGG - Intergenic
1032393275 7:131570675-131570697 GGAACCTGCAGGGCACTGGGCGG - Intergenic
1032416338 7:131738179-131738201 AGCACCTGCGGGGGAGGGGCGGG + Intergenic
1032752325 7:134853864-134853886 GGGACCTGTCGGGGTGGGGGTGG - Intronic
1034164355 7:149014212-149014234 TGCACAGGCCGGGGGGTGGGTGG - Intronic
1034435222 7:151060047-151060069 GGAGCCAGCCGGGGAGTGGGAGG - Intronic
1034673494 7:152874516-152874538 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1034722579 7:153308171-153308193 GGAGCCTGTCGGGGGGTGGGGGG + Intergenic
1034904747 7:154934253-154934275 AGCAGCTGGCGGGGGGTGGGGGG - Intronic
1035607425 8:939047-939069 GGCCCCTGCCTGGGAGTGGGAGG + Intergenic
1036346051 8:7964064-7964086 GGAACCTGTCTGGGAGTGAGTGG - Intergenic
1036406156 8:8456922-8456944 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
1036863183 8:12371069-12371091 GGAACCTGTCTGGGAGTGAGTGG - Intergenic
1036936082 8:13003941-13003963 GGCTGCTGCCAGGGAGTTGGAGG - Intronic
1037519288 8:19664054-19664076 GGCACCTGGCAGGGTGTGGAGGG - Intronic
1037820473 8:22132543-22132565 GGAGCCAGCCTGGGAGTGGGAGG - Intronic
1037829768 8:22180508-22180530 GGGACCCGCAGGGGAGGGGGAGG - Intronic
1038101426 8:24381304-24381326 GGGGCCTGCTGGGGGGTGGGGGG - Intergenic
1038750903 8:30294895-30294917 GGGGCCTGTCGGGGGGTGGGTGG - Intergenic
1039385507 8:37132075-37132097 GGCAGGTGGCGGGGGGTGGGGGG - Intergenic
1039542494 8:38382949-38382971 GGCGCCTGCCGGGGAGGTCGAGG - Intergenic
1039926028 8:41933121-41933143 GGCTGCTGCTGGGGAGGGGGTGG + Exonic
1040593713 8:48818684-48818706 GGCACCCACCTGGGTGTGGGGGG + Intergenic
1040942484 8:52846865-52846887 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
1041246858 8:55896493-55896515 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1041284940 8:56251025-56251047 GGCAGATGCCGGGGGGTGGGAGG - Intergenic
1042070256 8:64925476-64925498 GGGACCTGTCAGGGGGTGGGGGG - Intergenic
1042085127 8:65099029-65099051 GGGGCCTGCCGGGGGGTCGGGGG + Intergenic
1042116098 8:65433168-65433190 GGGGCCTGCTGGGGGGTGGGGGG - Intergenic
1043521152 8:81046847-81046869 GGGACCTGCCGGAGGGTTGGGGG - Intronic
1043532963 8:81171174-81171196 GGGGCCTGTCAGGGAGTGGGGGG + Intergenic
1043911387 8:85868436-85868458 GGGACCTGTCAGGGGGTGGGAGG - Intergenic
1044053391 8:87538396-87538418 GGGGCCTGCTGGGGGGTGGGGGG - Intronic
1044707738 8:95024933-95024955 GGAACCTGCAGGGGCGTGGCCGG + Intronic
1044814995 8:96102778-96102800 GGGGCCTGTCGTGGAGTGGGGGG - Intergenic
1045148346 8:99373151-99373173 GGCACCTGTTGGGAGGTGGGGGG + Intronic
1046024609 8:108707174-108707196 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1046260607 8:111762702-111762724 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1047219870 8:122910726-122910748 GGCCCCTGCTGGGGGGTGGGGGG + Intronic
1047300666 8:123611222-123611244 AGGGCCTGCTGGGGAGTGGGGGG - Intergenic
1047662076 8:127048073-127048095 GGGACCTGTCAGGGTGTGGGGGG + Intergenic
1048735046 8:137489827-137489849 GGCACCCACTGGGGGGTGGGGGG + Intergenic
1048964615 8:139606474-139606496 GGCACCTCCTGGGGAGGGTGGGG - Intronic
1049410226 8:142470714-142470736 GGATCCTGCAGGGGTGTGGGAGG + Intronic
1049573388 8:143379776-143379798 GGCACCACCTGGAGAGTGGGAGG + Intronic
1049607643 8:143537096-143537118 TGCACCTGCTGGGCAGAGGGCGG - Intronic
1049882106 8:145072265-145072287 GGGGCCTGTCGGGGGGTGGGAGG - Intergenic
1050071554 9:1820291-1820313 GGGACCTGTCAGGGGGTGGGGGG - Intergenic
1050181456 9:2927364-2927386 GGAGCCTGTCAGGGAGTGGGAGG + Intergenic
1050477614 9:6056556-6056578 GGGACCTGTCGTGGGGTGGGGGG - Intergenic
1051451095 9:17198681-17198703 GGGGCCTGTTGGGGAGTGGGGGG - Intronic
1051497256 9:17737191-17737213 GGCGCCTGTCAGGGGGTGGGGGG + Intronic
1051498947 9:17756477-17756499 GGGGCCTGCCGTGGGGTGGGGGG - Intronic
1052143500 9:25019740-25019762 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
1052207095 9:25855558-25855580 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1052264768 9:26559166-26559188 GGGGCCTGTCGGGGGGTGGGAGG + Intergenic
1052290776 9:26837593-26837615 GGGGCCTGTCGGGGAGTGGCGGG + Intergenic
1052539798 9:29795833-29795855 GGGGCCTGCTGGGGGGTGGGGGG - Intergenic
1053007299 9:34612632-34612654 GACACCTGCCGCGGAGTCTGGGG + Intergenic
1053152239 9:35750390-35750412 GGCATTTGCCTGGGAGAGGGGGG + Intronic
1053388131 9:37711509-37711531 GACAGCTGCCCGGCAGTGGGTGG + Intronic
1054757222 9:68971146-68971168 GGGGCCTGTCGGGGAGTGGGGGG - Intronic
1054794918 9:69291763-69291785 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1054984069 9:71241485-71241507 GGGGCCTGCCGTGGGGTGGGGGG + Intronic
1055768019 9:79686185-79686207 GGTATCTGCAGGGGAGAGGGAGG + Intronic
1056240841 9:84645120-84645142 GGGACCTGTCGTGGGGTGGGGGG - Intergenic
1057290286 9:93802001-93802023 GGCACCTGCCCAGGGGTGTGTGG + Intergenic
1057575620 9:96240061-96240083 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1057881365 9:98795440-98795462 GGCAGATGCCAGGGAGTTGGGGG - Intronic
1058356929 9:104094135-104094157 GGCCCCTGCCGGGGAGTCCCCGG + Intergenic
1058726386 9:107808594-107808616 GGGGCCTGTCGGGGAGTTGGGGG + Intergenic
1059248615 9:112868330-112868352 GGCACCTGACTTGGAGCGGGTGG - Intronic
1059389910 9:113992539-113992561 GGCACTTGGCGGGGAGTGCTGGG + Intronic
1059411674 9:114136481-114136503 CACACCTTCCGAGGAGTGGGAGG - Intergenic
1059955230 9:119508936-119508958 GGGGCCTGTCTGGGAGTGGGGGG - Intronic
1060406429 9:123375266-123375288 GGCACCTGCCGGGCAGCTGGAGG + Exonic
1060886232 9:127154327-127154349 GGCTCCTGCCATGGAGTAGGAGG + Intronic
1060945890 9:127569150-127569172 GGCAGCGGGCGGGGAGGGGGCGG - Intronic
1061542185 9:131283302-131283324 GGCAGCTGCAGGGGAGAGGAGGG - Intergenic
1061820416 9:133224535-133224557 GGGGCCTGTCGTGGAGTGGGGGG - Intergenic
1062019915 9:134314447-134314469 GGCACCTCCTGGGGAGTTGTAGG - Intergenic
1062161582 9:135083355-135083377 GGAACCTGCCAGGGAGAGTGCGG + Intronic
1062209475 9:135356007-135356029 GGCTCCGGCTGGGGAGGGGGAGG - Intergenic
1062298318 9:135847688-135847710 CACACCTGTCGGGGGGTGGGAGG + Intronic
1062742759 9:138189159-138189181 GGGGCCTGTCGGGGGGTGGGAGG - Intergenic
1203778078 EBV:85270-85292 GGCCTCTGCCGGGGAACGGGTGG - Intergenic
1203778100 EBV:85330-85352 GGCCTCTGCCGGGGAACGGGCGG - Intergenic
1185679912 X:1880018-1880040 AGGGCCTGCCGGGGGGTGGGGGG + Intergenic
1186755085 X:12662353-12662375 GGGCCCTGTCGGGGGGTGGGGGG - Intronic
1186904533 X:14097343-14097365 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1187414837 X:19084307-19084329 GGGGCCTGTCGGGGAGGGGGTGG + Intronic
1187548657 X:20279356-20279378 GGGACCCGTCGGGGGGTGGGGGG + Intergenic
1187665454 X:21604305-21604327 GGGGCCTGCTGTGGAGTGGGGGG + Intronic
1187669051 X:21650415-21650437 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1187726435 X:22208038-22208060 GGGGCCTGTCGGGGGGTGGGGGG - Intronic
1188036219 X:25320055-25320077 GGGCCCTGTCAGGGAGTGGGGGG - Intergenic
1188178289 X:27021937-27021959 GGGGCCTGTCAGGGAGTGGGGGG - Intergenic
1188409214 X:29850563-29850585 GGCTCCAGCAGGGGAGAGGGTGG - Intronic
1188818814 X:34748377-34748399 GGCGCCTGTCGTGGGGTGGGGGG + Intergenic
1188950714 X:36370252-36370274 GGGGCCTGCTGGGGGGTGGGGGG - Intronic
1189844731 X:45124234-45124256 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1190509272 X:51160273-51160295 GGTACCTGGCAGGGAATGGGTGG - Intergenic
1190522887 X:51298377-51298399 GGCTGCTGCCAGGGTGTGGGAGG - Intergenic
1190737752 X:53266880-53266902 GGAATCTGCGGGGGGGTGGGTGG + Intronic
1191043588 X:56112321-56112343 GGGGCCTGCCATGGAGTGGGGGG + Intergenic
1191061848 X:56306581-56306603 GGGGCCTGTCGGGGAGTGGGGGG - Intergenic
1191175023 X:57490318-57490340 GGGACCTGTCAGGGAGTGGGGGG - Intergenic
1191973636 X:66845425-66845447 GGGGCCTGTCGGGGGGTGGGAGG + Intergenic
1192086701 X:68105646-68105668 GGGGCCTGTCGGGGGGTGGGGGG + Intronic
1192210320 X:69123690-69123712 AGCACCTGGCAGGGGGTGGGTGG - Intergenic
1192271162 X:69580865-69580887 GGGACCTGTCGGGGGGTGGGGGG + Intergenic
1192364019 X:70455851-70455873 AGCACCTGCCAGGGAGAGGTCGG - Intronic
1192690494 X:73357644-73357666 GGGGCCTGTCGGGGGGTGGGAGG + Intergenic
1192925854 X:75754424-75754446 GGGGCCTGCCGTGGGGTGGGGGG - Intergenic
1193343765 X:80382709-80382731 GGCAGCAGCCTGGCAGTGGGGGG - Intronic
1193794334 X:85854505-85854527 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1194159113 X:90428717-90428739 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1194572475 X:95569892-95569914 GGGGCCTGCCGGGGAGAGCGGGG - Intergenic
1194610316 X:96035396-96035418 GGCGCCTGTCAGGGGGTGGGGGG + Intergenic
1194761205 X:97798064-97798086 GGGGCCTGTCGTGGAGTGGGGGG - Intergenic
1195345625 X:103948028-103948050 GGAGCCTGTCGGGGAGCGGGGGG + Intronic
1195722845 X:107883190-107883212 GGGGCCTGTCGGGGAGTGGGGGG + Intronic
1196037976 X:111167713-111167735 GGGGCCTGTCGGGGAGTAGGGGG + Intronic
1196297691 X:114017691-114017713 GGGTCCTGTCGGGGGGTGGGGGG - Intergenic
1196689191 X:118541256-118541278 TGCAACTGCGGGGGAGCGGGGGG - Intronic
1197135278 X:123053013-123053035 GGTGCCTGTCGGGGGGTGGGGGG + Intergenic
1197576354 X:128216933-128216955 GGGGCCTGTCAGGGAGTGGGGGG + Intergenic
1197618030 X:128715939-128715961 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1198161794 X:134015515-134015537 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1198478405 X:137017827-137017849 GGCACTTGCCAGGTAGTGTGAGG - Intergenic
1198879232 X:141261365-141261387 GGGGCCTGTCGGGGGGTGGGGGG - Intergenic
1198884670 X:141321407-141321429 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1198945582 X:142009707-142009729 GGGGCCTGTCGGGGAGTCGGGGG - Intergenic
1199027139 X:142953406-142953428 GGGGCCTGTCGGGGTGTGGGGGG - Intergenic
1199078888 X:143554641-143554663 GGGGCCTGTCGGGGGGTGGGAGG + Intergenic
1199149857 X:144418395-144418417 GGGGCCTGTTGGGGAGTGGGGGG + Intergenic
1199437142 X:147825392-147825414 GGGGCCTGTCGGGGGGTGGGGGG + Intergenic
1200982347 Y:9273722-9273744 GGTACCTGCTGGGCAGTGTGGGG - Intergenic
1201145394 Y:11062324-11062346 TGGGCCTGCTGGGGAGTGGGTGG - Intergenic
1201854542 Y:18527060-18527082 GGGGCCTGTCGGGGAGTAGGGGG + Intergenic
1201878779 Y:18793325-18793347 GGGGCCTGTCGGGGAGTAGGGGG - Intronic
1202091805 Y:21198696-21198718 GGGACCTGCCAGGGGGTGGAGGG - Intergenic
1202113226 Y:21446247-21446269 GGTACCTGCCAGGCAGTGTGGGG - Intergenic
1202128059 Y:21586008-21586030 GGCACCTGCTGGGCAGTGTGGGG + Intergenic