ID: 985645226

View in Genome Browser
Species Human (GRCh38)
Location 5:1081811-1081833
Sequence AGTGGCACCTGCCGGGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 259}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985645226_985645238 -5 Left 985645226 5:1081811-1081833 CCCACTCCCCGGCAGGTGCCACT 0: 1
1: 0
2: 1
3: 20
4: 259
Right 985645238 5:1081829-1081851 CCACTGGTGGCCGGAGGGGAAGG 0: 1
1: 0
2: 4
3: 25
4: 340
985645226_985645241 21 Left 985645226 5:1081811-1081833 CCCACTCCCCGGCAGGTGCCACT 0: 1
1: 0
2: 1
3: 20
4: 259
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37
985645226_985645235 -10 Left 985645226 5:1081811-1081833 CCCACTCCCCGGCAGGTGCCACT 0: 1
1: 0
2: 1
3: 20
4: 259
Right 985645235 5:1081824-1081846 AGGTGCCACTGGTGGCCGGAGGG 0: 1
1: 0
2: 2
3: 15
4: 146
985645226_985645239 -4 Left 985645226 5:1081811-1081833 CCCACTCCCCGGCAGGTGCCACT 0: 1
1: 0
2: 1
3: 20
4: 259
Right 985645239 5:1081830-1081852 CACTGGTGGCCGGAGGGGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 328
985645226_985645236 -9 Left 985645226 5:1081811-1081833 CCCACTCCCCGGCAGGTGCCACT 0: 1
1: 0
2: 1
3: 20
4: 259
Right 985645236 5:1081825-1081847 GGTGCCACTGGTGGCCGGAGGGG 0: 1
1: 0
2: 1
3: 19
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985645226 Original CRISPR AGTGGCACCTGCCGGGGAGT GGG (reversed) Intronic
900094088 1:933381-933403 AGTGGCACCTGGTGGGGAGCTGG - Intronic
900151267 1:1180250-1180272 AGGGGCTCCTGCTGGGGGGTGGG + Exonic
900634871 1:3658024-3658046 AGAGGCACCTCTCAGGGAGTTGG + Intronic
901221439 1:7586113-7586135 AGTGGAGCCTGGCTGGGAGTGGG - Intronic
902742871 1:18452052-18452074 ACTGGGACCTGTCGGGGGGTGGG + Intergenic
903000946 1:20265413-20265435 AGGGGCAGCTGCCTGGGAGGAGG - Intergenic
903028943 1:20448987-20449009 AGCGGCACCAGCTGGGGAGTGGG - Intergenic
904648638 1:31987556-31987578 AGAGGCATCTGCCTGGCAGTTGG - Intergenic
904844384 1:33397893-33397915 AGTGATGCCTCCCGGGGAGTAGG + Intronic
905240248 1:36576559-36576581 AGTGGGACCTCCAGGGGTGTGGG + Intergenic
905269471 1:36777730-36777752 AGTGGCCCCTGCCTGGGAGAGGG + Intergenic
905918118 1:41699816-41699838 AGAGGCCCCTACCGGGGTGTGGG - Intronic
906210918 1:44011715-44011737 AGCGTCACCTGCAGGGGAGGGGG + Exonic
907939332 1:59072418-59072440 AGAGGCACCTGCAGGGGGGCAGG - Intergenic
908223593 1:62033839-62033861 TGTGGTACCTGGCAGGGAGTAGG - Intronic
910523746 1:88153737-88153759 AGTGGGGCCTGTCGAGGAGTGGG + Intergenic
915531531 1:156505038-156505060 GGTGGCAGCTGCAGGAGAGTGGG + Intergenic
917192954 1:172437570-172437592 ACTGGGGCCTGCCGGGGGGTGGG + Intronic
917268395 1:173246311-173246333 ACTGGAACCTGTTGGGGAGTTGG - Intergenic
918913890 1:190609738-190609760 ACTGGGACCTGCCTTGGAGTGGG + Intergenic
919764109 1:201115272-201115294 AGGGGCGCCTGCCGGGGAGGGGG + Exonic
920429228 1:205905445-205905467 ACTGGGACCTGTCGGGGGGTGGG + Intergenic
921755162 1:218846879-218846901 AGTGGGACCTGTCGGGGGCTGGG + Intergenic
921861415 1:220046153-220046175 AGATGCACCTGCCGGGGACACGG + Intronic
922697108 1:227736087-227736109 AGTGGCACCTGGAGGGGACATGG + Intronic
922784203 1:228275063-228275085 AGTTGCACCTGGTGGGGAATGGG + Intronic
923043391 1:230336433-230336455 AGTGGCTGCTGCAGGGGAGCAGG + Intronic
1065277459 10:24099339-24099361 ACTGGGACCTGCCGTGGGGTAGG - Intronic
1065590074 10:27254437-27254459 ACTGGGGCCTGTCGGGGAGTGGG - Intergenic
1068565442 10:58569546-58569568 ACTGGGACCTGCCAGGGGGTGGG - Intronic
1069390913 10:67933941-67933963 AGTGGCTGTTGCCAGGGAGTTGG - Intronic
1070765842 10:79055859-79055881 AGTGGCTCCTTCTGGGAAGTAGG + Intergenic
1075240538 10:120774533-120774555 AGTGGCACCTGGCAGAGAGGTGG + Intergenic
1076402009 10:130190719-130190741 AGTGGCGGCTGCCGGGAAGCAGG + Intergenic
1077386633 11:2272265-2272287 AGTAGCACCTGCCTGGGAGCTGG + Intergenic
1078509226 11:11973353-11973375 AGTAGCACCTGCCCGGGACAGGG + Intronic
1078698302 11:13657229-13657251 ACTGGGACCTGTTGGGGAGTGGG + Intergenic
1078870237 11:15336340-15336362 ACTGGCATGTGCCAGGGAGTAGG - Intergenic
1081043049 11:38235457-38235479 ACTGGGGCCTGTCGGGGAGTGGG + Intergenic
1081570841 11:44289883-44289905 AGTGGGTCCTGCCGGGGACAGGG - Intronic
1081876039 11:46408974-46408996 ACAGGCCCCTGTCGGGGAGTGGG + Intronic
1082056586 11:47822724-47822746 ACTGGCACCTGTCGTGGGGTAGG - Intronic
1084683901 11:70682522-70682544 AGTGGCCCCTTCTGGGAAGTGGG + Intronic
1084989022 11:72905593-72905615 ACTGGGACCTGTCGGGGGGTGGG - Intronic
1085441385 11:76566613-76566635 AGTGGGGCCTGTCGGGGGGTAGG + Intergenic
1087596691 11:100262775-100262797 ACTGGGGCCTGCCAGGGAGTGGG + Intronic
1088595333 11:111436748-111436770 AGGGGCACCTGCCGGGGGAGGGG - Intronic
1088830910 11:113536106-113536128 ACTGGGGCCTGCCGGGGTGTCGG + Intergenic
1089561084 11:119343566-119343588 AGTGGCCCCTGCCGGTGGGGAGG + Intronic
1091335304 11:134762094-134762116 AGTGGCCCCTGCCTGGGTGCAGG - Intergenic
1092028916 12:5267585-5267607 ACTGGGGCCTGTCGGGGAGTGGG + Intergenic
1092111815 12:5969745-5969767 AGTGGCACCAGCCTGGGAAATGG - Intronic
1092204367 12:6606616-6606638 GGGGGCGCCTGCCGGGGAGCCGG - Intronic
1092320528 12:7469156-7469178 ACTGGGGCCTGTCGGGGAGTTGG + Intronic
1092454945 12:8634791-8634813 AGTGGATCCTGCCTGGGAGGAGG + Intergenic
1095681941 12:44987353-44987375 ACTGGGGCCTGTCGGGGAGTGGG - Intergenic
1095690600 12:45084266-45084288 ACTGGCACCTACTGGGGGGTGGG - Intergenic
1096545698 12:52338662-52338684 AGAGGCTCCTGCCAGGGAGAAGG - Intergenic
1098330046 12:69343724-69343746 ATTGGCTCCTGCCTGGGAGGTGG + Intergenic
1098606666 12:72398926-72398948 ACTGGCACCAGCCTGGGGGTTGG - Intronic
1098890624 12:76006751-76006773 AGTGACAGCTGCCGGGGAGGAGG - Intergenic
1099809463 12:87562192-87562214 AGTGGGGCCTGTCAGGGAGTGGG + Intergenic
1101272498 12:103162377-103162399 AGTGGGCCCTGCAGGGGATTTGG - Intronic
1101767082 12:107711557-107711579 AGTGGCCCCTTCCGGAAAGTTGG - Intronic
1102961135 12:117094016-117094038 AGTGGGACCTGACGGAGAGAAGG - Intronic
1103334097 12:120176284-120176306 AGTGGCATTTGCTGGGGAGTAGG - Intronic
1103750076 12:123152041-123152063 AGGGGCACCTGGAGGCGAGTCGG - Intergenic
1103928496 12:124436625-124436647 AGTGGCTGATGCCGGGGAGATGG - Intronic
1106548796 13:30753735-30753757 AGTGCCTCCTGCAGGGAAGTGGG - Intronic
1108075972 13:46680157-46680179 AGTGGGACCTGCATGGGATTTGG + Intronic
1110199159 13:72828431-72828453 ACCGGCGCCTGTCGGGGAGTGGG - Intronic
1111454831 13:88466794-88466816 ACTGGGACCTGTCGGGGTGTGGG + Intergenic
1113718516 13:112533274-112533296 AGTTCCTCCTGCCTGGGAGTCGG - Intronic
1116689073 14:48081454-48081476 ACTGGGGCCTGCCGGGGGGTGGG + Intergenic
1117362539 14:54991256-54991278 AATGGCTTTTGCCGGGGAGTTGG + Exonic
1118370936 14:65136668-65136690 AGTGGCAACTGTGGGGGAGGAGG - Intergenic
1119261335 14:73239859-73239881 GGAGGAACCTGCAGGGGAGTCGG + Intronic
1119587630 14:75851555-75851577 AGTGGCTCCTGTGGGGAAGTGGG - Intronic
1119804653 14:77475032-77475054 AGTGGCTCGTGGCAGGGAGTGGG + Exonic
1122126061 14:99579428-99579450 AGTGGGACCTACAGGGGAGCTGG + Intronic
1124215624 15:27805554-27805576 TGTGGCAGCTGCCCGGGTGTTGG + Intronic
1124242083 15:28037177-28037199 AGTGGGACCAGCCTGGGAGTGGG + Intronic
1125502539 15:40248481-40248503 AGCAGGACCTGCCGGGGAGGTGG - Intronic
1126365119 15:47886309-47886331 AGTGGCACGGGGTGGGGAGTGGG + Intergenic
1128044842 15:64608643-64608665 ATTGGCAGCTGCCAGGGATTAGG - Intronic
1132390795 15:101436874-101436896 ACGGGCACTTGTCGGGGAGTGGG - Intronic
1132525468 16:412021-412043 AGTTGCTCCTGCCCTGGAGTTGG - Exonic
1132881322 16:2162919-2162941 AGTGGGACCTGCTCGGGAGGAGG + Intronic
1135868905 16:26130795-26130817 AGTTCCACCTGCCAGGGAGTAGG - Intronic
1136514750 16:30761480-30761502 GGTGGCGCCTGCGGGGGAGCCGG + Intronic
1136542367 16:30935243-30935265 AATGGCACCTGGCGGACAGTGGG + Intronic
1136568265 16:31082565-31082587 AGCCGCAGCTGCCAGGGAGTGGG + Intronic
1136910747 16:34142451-34142473 AGTGGCTCACACCGGGGAGTGGG + Intergenic
1138526716 16:57612735-57612757 AGTGTCTCCTCCCTGGGAGTGGG + Intronic
1139363559 16:66418966-66418988 AGAGGCACCAGCCGGGAAGGTGG + Intergenic
1141670508 16:85489342-85489364 AGTGGCCCCTGCCTGTCAGTGGG + Intergenic
1141699934 16:85637774-85637796 AGCCACACCTGCCGGGGAGTGGG + Intronic
1142028128 16:87825179-87825201 AGTGGGACCTCACGGGGAGACGG + Intergenic
1142243403 16:88957317-88957339 AGTGGCATCTGCCGTGGGGGCGG - Intronic
1142245854 16:88969739-88969761 AGTGGCAGGTGCCGGGGGGCAGG + Intronic
1143497055 17:7318349-7318371 ATTGTCACCTGCAGGGGAGAGGG + Exonic
1143580445 17:7822442-7822464 AGGTGCACACGCCGGGGAGTAGG - Intronic
1144643790 17:16954779-16954801 ACTGGCACCTGCCTTGGAATGGG - Intronic
1144686514 17:17229522-17229544 AATGGCAGCTGCCGGGGACTGGG + Intronic
1144996528 17:19273187-19273209 AGAGGCTCCTGAAGGGGAGTAGG - Intronic
1145204999 17:20979607-20979629 ACTGGCACCTGCCTTGGAATGGG + Intergenic
1148218438 17:45846593-45846615 AGAGGCACCAGCCGAGGAGCAGG + Exonic
1152122068 17:78424919-78424941 AGTGGCAGCAGCTGGGGAGTGGG + Intronic
1152276871 17:79363121-79363143 CGTGGCTCCTGCAGGGGAGATGG + Intronic
1153535829 18:6100752-6100774 ATTGGCACCAGGTGGGGAGTGGG + Intronic
1155763201 18:29591726-29591748 ACTGGGGCCTGTCGGGGAGTAGG + Intergenic
1157676329 18:49571414-49571436 AGTGGCATCTGCTGGGGTGAGGG + Intronic
1158431750 18:57394766-57394788 ATTGGGGCCTGTCGGGGAGTGGG - Intergenic
1159785955 18:72714446-72714468 AGTGACACCTGCCAAGGAGATGG + Intergenic
1159947749 18:74456944-74456966 GGTGGCACCCGCCGGGGACATGG - Intronic
1160235113 18:77079304-77079326 AGTGGCACCTGGCGGGCACTGGG + Intronic
1160261829 18:77301278-77301300 ATGGGCACGTGCTGGGGAGTGGG + Intergenic
1163410264 19:17149637-17149659 AGTGTCACCTGCCTGAAAGTGGG - Intronic
1163758208 19:19119534-19119556 TGTGGCACCTGCCCGGGTGCAGG - Intronic
1164595960 19:29530691-29530713 ACTGGCACCTGCTGGAGAGCGGG + Intronic
1164694229 19:30231597-30231619 TGTGGTACCTGCTCGGGAGTTGG + Intronic
1165293303 19:34906177-34906199 AGTGGCAGCAGCGGGCGAGTTGG - Intergenic
1166408830 19:42542835-42542857 AGGGACACCTGCAGGGGGGTGGG + Intronic
1166580479 19:43894205-43894227 ACTGGAGCCTGTCGGGGAGTTGG - Intronic
1167499143 19:49835812-49835834 AGGGGCACCTGGCGGGGGCTGGG - Exonic
1168078152 19:53991723-53991745 AGGGGCCCCTGCTCGGGAGTCGG + Intergenic
1168558420 19:57363205-57363227 AGTGGCACCGTCAGGGGAGCTGG - Intergenic
925238573 2:2300921-2300943 AGTAGCTCCTGCAGGAGAGTGGG - Intronic
925325508 2:3018576-3018598 ACTGGGGCTTGCCGGGGAGTGGG - Intergenic
925929268 2:8694119-8694141 AGTGGGGGCTGGCGGGGAGTGGG + Intergenic
926118585 2:10228747-10228769 AGTGGCGCCTGGGAGGGAGTTGG - Intergenic
927138121 2:20112096-20112118 AGAGTCACCTGCCCAGGAGTTGG - Intergenic
927790177 2:26003443-26003465 AGTGGGAACTGTCGGGGAGGGGG - Intergenic
932297747 2:70641223-70641245 TGTGGCACCTGGAGGGGAGCAGG - Intronic
932593713 2:73081507-73081529 AGTGGCAGCAGCGGGGGAGGCGG + Intronic
932949979 2:76281650-76281672 GGTGCCACCTGCTGGGGACTGGG - Intergenic
934655846 2:96116552-96116574 AGCCGCGCCTGCAGGGGAGTGGG + Intergenic
935418294 2:102841422-102841444 AGTGACACCTGCTGGGAAGAAGG - Intronic
936181797 2:110273675-110273697 ACTGGGGCCTGTCGGGGAGTGGG - Intergenic
936230770 2:110698004-110698026 ACTGGGGCCTGTCGGGGAGTGGG + Intergenic
940945676 2:159615546-159615568 AGAGGCCCAAGCCGGGGAGTGGG + Intronic
942763592 2:179428394-179428416 AATGGCTCCTGCCTGGGAGAAGG + Intergenic
943500306 2:188680734-188680756 AGTGGGGCCTGCCGTGGGGTGGG - Intergenic
945006779 2:205417084-205417106 ACTGGGGCCTGCCGGGGGGTGGG - Intronic
945329139 2:208519400-208519422 AGTGGGGCCTGTCAGGGAGTGGG - Intronic
946591239 2:221250428-221250450 GGTGGCAACTGCCGTGGTGTGGG + Intergenic
946847580 2:223873128-223873150 ACTGGGGCCTGTCGGGGAGTGGG + Intronic
948274610 2:236698721-236698743 TGTGCCTCCTGCCAGGGAGTTGG + Intergenic
948726604 2:239938122-239938144 AGTGGGGACTGCTGGGGAGTGGG - Intronic
1169129699 20:3159740-3159762 AGTGGCGGCGGCCGGGGAGGAGG - Intronic
1169971153 20:11270802-11270824 AGTGGCACCAGCAGGAGATTCGG + Intergenic
1172428618 20:34872854-34872876 AGTGGCTGCGGCGGGGGAGTGGG + Exonic
1173839229 20:46146345-46146367 AGGTGCACCTGCAGGAGAGTGGG + Intergenic
1173977280 20:47196561-47196583 AGTGGCACCTGCGGGCGGCTGGG - Intergenic
1175330415 20:58159918-58159940 AATGGAACCTGCCGGTGAGGCGG - Intronic
1176120375 20:63451857-63451879 AGAGGCCGCTGCTGGGGAGTCGG - Intronic
1177371599 21:20211086-20211108 ATTTGTACATGCCGGGGAGTCGG + Intergenic
1179504673 21:41832705-41832727 ATTTGCACCTGCCTGGGAGGGGG - Intronic
1179937257 21:44613508-44613530 AGAGTCACCTGCCGGGAAGCTGG + Intronic
1180049657 21:45325394-45325416 GGTGGGACTTGCCGGGGTGTAGG - Intergenic
1181309741 22:21938195-21938217 AGCGCCACCTGCCGGTGAGAAGG - Intronic
1182435371 22:30326560-30326582 AGTGGTCCCTGCCTGGGAGGGGG + Intronic
1182521080 22:30884812-30884834 AGTGACACCTACCGGGGGGTGGG - Intronic
1182995152 22:34805346-34805368 ACTGGGACCTGTCAGGGAGTGGG - Intergenic
1183365184 22:37403188-37403210 AGGTGCACCTGCCTGGGGGTGGG - Intronic
1183745085 22:39687366-39687388 AGGGGCACCTGCAGGGCAGCTGG - Exonic
1184881286 22:47305992-47306014 AGTGGCAGCTGCCCAGGAGAGGG - Intergenic
952117521 3:30200541-30200563 ACTGGGGCCTGCCGGGGGGTGGG - Intergenic
953609054 3:44432450-44432472 AGTGGCACCTGCTGTGGAGCAGG + Intergenic
955338223 3:58104552-58104574 AGTTGCACCTCCAGGGGAGCTGG - Intronic
960291675 3:115893133-115893155 ACTGGGGCCTGTCGGGGAGTGGG + Intronic
960787163 3:121386557-121386579 ACTGGGACCTGTCGGGGGGTGGG - Intronic
961402403 3:126656486-126656508 GGTGGCAACTGCAGGGGAGAAGG - Intergenic
964761483 3:160138447-160138469 AGTGGGGCCTGTCGGGGGGTGGG + Intergenic
964936272 3:162092351-162092373 ACTGGGACCTGTTGGGGAGTGGG - Intergenic
967710852 3:192706469-192706491 AGTGGCACTGGGCGGGGAGCCGG - Intronic
967955155 3:194872234-194872256 TCTGGCACCTGGCAGGGAGTGGG + Intergenic
968262062 3:197333480-197333502 AATGGGACCTGTCGGGGTGTCGG - Intergenic
968434766 4:578764-578786 AGCGGCACCTGGAGGGCAGTGGG - Intergenic
968573137 4:1352929-1352951 AGTGACACCCTGCGGGGAGTGGG + Intronic
968962727 4:3753511-3753533 AGTGGCACCTGTGGGGCAGGAGG + Intergenic
969652446 4:8475674-8475696 ATTGGCACCTCCCGTGGCGTGGG + Intronic
972219846 4:36941572-36941594 ACCGGGGCCTGCCGGGGAGTCGG + Intergenic
975408752 4:74023089-74023111 AGTGGGGCCTGTCGGGGGGTGGG + Intergenic
980799953 4:137734991-137735013 AGCGGGGCCTGTCGGGGAGTCGG + Intergenic
983135411 4:164073482-164073504 AGTGGGGCCTGTCAGGGAGTGGG + Intronic
984271086 4:177549367-177549389 AGTGGCACCTCCCGAGTAGCTGG - Intergenic
984510722 4:180675452-180675474 AGTGGCATCTGCTGGGGGGTGGG + Intergenic
985580828 5:694299-694321 AGGGGCACCTGCCCTGGAGGAGG + Intergenic
985595450 5:785631-785653 AGGGGCACCTGCCCTGGAGGAGG + Intergenic
985645226 5:1081811-1081833 AGTGGCACCTGCCGGGGAGTGGG - Intronic
986742386 5:10715370-10715392 AGTGGCACCTGGAGGTGGGTGGG - Intronic
988482262 5:31639984-31640006 ATTGGCGTCTGCCGGGGAGATGG + Intronic
990582120 5:57174669-57174691 CGTGGCACTTGCCGTGGACTGGG + Intronic
991100254 5:62784081-62784103 ACTGGCGCCTGTCGGGGGGTGGG - Intergenic
991484950 5:67125407-67125429 ACTGGGGCCTGTCGGGGAGTTGG - Intronic
992006071 5:72478752-72478774 GGTGGCACCTGCCAGGGAACTGG + Intronic
993959382 5:94278098-94278120 AGTGGGACCTGTCAGGGGGTTGG + Intronic
995324204 5:110872752-110872774 AGTGGCACCTGCTGGGAGGAGGG + Intergenic
996056427 5:118988213-118988235 GGCGCCCCCTGCCGGGGAGTCGG - Intronic
996445071 5:123538567-123538589 ACTGGGGCCTGTCGGGGAGTGGG + Intronic
997405044 5:133639131-133639153 ACTGGGGCCTGTCGGGGAGTGGG - Intergenic
997407255 5:133660639-133660661 AGTGGCACAGGCTGGGGAGAGGG - Intergenic
997737990 5:136228537-136228559 AGTGGCGGCTGCTGGGGAGGCGG + Intronic
998211083 5:140198961-140198983 ACTGGGGCCTGTCGGGGAGTTGG - Intronic
1001035293 5:168292461-168292483 GGAGGCGCCTGCCGGGGAGCTGG + Intronic
1001448246 5:171804041-171804063 AGTGGGGCCTGTCGGGGAATGGG + Intergenic
1001531670 5:172466390-172466412 AGAGACAGATGCCGGGGAGTGGG + Intergenic
1002661735 5:180795978-180796000 AGTGGCAGCTGGCTGGGAATTGG - Intronic
1003492391 6:6634955-6634977 AGTAGCACCTGCTGGGAAGGTGG - Intronic
1006260150 6:32861154-32861176 AGGGGCCCCTCCTGGGGAGTGGG + Intergenic
1007315252 6:40983109-40983131 AGAGGGAGCTGCAGGGGAGTGGG - Intergenic
1009027971 6:58022811-58022833 ACTGGCACCTGCCGTGGGGTGGG - Intergenic
1009203508 6:60774275-60774297 ACTGGCACCTGCCGTGGGGTGGG - Intergenic
1009331368 6:62424980-62425002 ACTGGGGCCTGTCGGGGAGTAGG + Intergenic
1012113233 6:95261978-95262000 AATGGCCCCTGCCAGGAAGTGGG + Intergenic
1012785373 6:103618400-103618422 ACTGGGGCCTGTCGGGGAGTAGG - Intergenic
1013902099 6:115169225-115169247 AGTGGGGCCTGTCGGGGGGTGGG - Intergenic
1015045742 6:128774283-128774305 ACTGGGGCCTGTCGGGGAGTGGG - Intergenic
1017087360 6:150726090-150726112 AGTGGTGCTTGCCAGGGAGTGGG + Intronic
1018393230 6:163356637-163356659 GGTGGCACCGGGCGGGGAGCAGG - Intergenic
1019544403 7:1566559-1566581 AGTGGGCCCTTCCAGGGAGTTGG - Intergenic
1019786387 7:2980134-2980156 AGTGCCAGGGGCCGGGGAGTGGG - Intronic
1020107577 7:5429231-5429253 GGTGGCACATGCCGGGGGCTTGG + Intergenic
1021751090 7:23800584-23800606 AGTGGGGCCTGTTGGGGAGTGGG + Intronic
1021758213 7:23876517-23876539 ACTGGGGCCTGTCGGGGAGTGGG - Intergenic
1022204198 7:28147761-28147783 AGTGTCAGCTACCTGGGAGTGGG + Intronic
1023031001 7:36090321-36090343 AGTGGGAGCTGGCGGGGGGTGGG - Intergenic
1023071297 7:36437154-36437176 AGTGGTGGCTGCCAGGGAGTGGG - Intronic
1023359951 7:39405810-39405832 AGAGAGACCTGCCGGGGAGGAGG - Intronic
1027674311 7:81141040-81141062 TGTGGCTGCTGCCAGGGAGTAGG - Intergenic
1027879259 7:83812580-83812602 ACTGGGACCTGTCAGGGAGTGGG - Intergenic
1029896561 7:103989874-103989896 AGGGGCGCCCGCCGGGGAGCGGG + Intergenic
1029964179 7:104721374-104721396 ACTGGGGCCTGTCGGGGAGTGGG + Intronic
1030730020 7:112976427-112976449 ACTGGGACCTGTCGGGGGGTTGG + Intergenic
1030871730 7:114764401-114764423 ACTGGGACCTGTCGGGGGGTGGG + Intergenic
1032191718 7:129769602-129769624 AGTGGCACTTCCCAGAGAGTTGG - Intergenic
1032552245 7:132795060-132795082 AGTGGCAGCTGCAGGGGCATTGG - Intronic
1033996242 7:147353302-147353324 ACTGGGGCCTGTCGGGGAGTAGG - Intronic
1035654585 8:1295855-1295877 CATGGCACCTGCCTGGGAATTGG + Intergenic
1038851141 8:31277446-31277468 TGTGGCACCTGCCTGAGATTGGG - Intergenic
1042070259 8:64925479-64925501 AGTGGGACCTGTCAGGGGGTGGG - Intergenic
1042958155 8:74273972-74273994 AGTGGCAAATGGCAGGGAGTGGG - Intronic
1043521155 8:81046850-81046872 ACTGGGACCTGCCGGAGGGTTGG - Intronic
1047358038 8:124141768-124141790 GGTGGCGCCTGTCGGGGAGGGGG + Intergenic
1049307959 8:141917347-141917369 ACTGGGGCCTGTCGGGGAGTGGG + Intergenic
1050071557 9:1820294-1820316 AGTGGGACCTGTCAGGGGGTGGG - Intergenic
1051751724 9:20349929-20349951 AGTGGCAGCAGCTGGGGAGTTGG + Intronic
1051883481 9:21864785-21864807 CGTGGCACCTGCAGGGCAGCTGG - Exonic
1052706133 9:31995814-31995836 ACCGGGACCTGTCGGGGAGTGGG + Intergenic
1053303249 9:36966458-36966480 AGAGGCATCTGGCGGGGTGTGGG - Intronic
1053856304 9:42342433-42342455 CGGGGCACCTGCTGGGAAGTGGG - Intergenic
1054757225 9:68971149-68971171 ACTGGGGCCTGTCGGGGAGTGGG - Intronic
1055570626 9:77613365-77613387 AATGGCAGTTGCCAGGGAGTAGG + Intronic
1058726383 9:107808591-107808613 ACTGGGGCCTGTCGGGGAGTTGG + Intergenic
1060406428 9:123375263-123375285 GGGGGCACCTGCCGGGCAGCTGG + Exonic
1060434830 9:123584433-123584455 AGTGGCACCAGTCGGGGAATGGG + Intronic
1203778121 EBV:85393-85415 AGTGCCAGCTGCATGGGAGTGGG - Intergenic
1185430838 X:10921-10943 AGGGGCTCCTGTCGGGGACTGGG - Intergenic
1185440104 X:223318-223340 AGGGGCTCCTGTCGGGGACTGGG - Intergenic
1185716477 X:2346804-2346826 ACTGGGGCCTGTCGGGGAGTAGG - Intronic
1186878538 X:13841236-13841258 GGAGGCATCTGCTGGGGAGTGGG - Intronic
1188596702 X:31910074-31910096 GGTGGCATTTGCCTGGGAGTTGG + Intronic
1191061851 X:56306584-56306606 ACTGGGGCCTGTCGGGGAGTGGG - Intergenic
1191175026 X:57490321-57490343 ACTGGGACCTGTCAGGGAGTGGG - Intergenic
1191810307 X:65179243-65179265 AGTGGGGCCTGTCGGGGTGTTGG + Intergenic
1191928109 X:66338038-66338060 ACTGGGGCCTGTCGGGGAGTGGG - Intergenic
1192019054 X:67364820-67364842 ACTGGGACCTGCTGGGGGGTGGG + Intergenic
1192271159 X:69580862-69580884 ACTGGGACCTGTCGGGGGGTGGG + Intergenic
1192366212 X:70475732-70475754 AGTGGTATCTTCTGGGGAGTGGG + Intronic
1193934488 X:87600197-87600219 TGTAGCACCAGCCGGGGAGGTGG + Intronic
1194765520 X:97843248-97843270 AGTGGCCCCTGCCGGGGAGGTGG - Intergenic
1195722842 X:107883187-107883209 ACTGGGGCCTGTCGGGGAGTGGG + Intronic
1196554520 X:117070882-117070904 AGTGGCACCTGCAATGTAGTGGG - Intergenic
1198445349 X:136708199-136708221 ACTGGGGCCTGTCGGGGAGTGGG + Intronic
1198783936 X:140266988-140267010 ACTGGGGCCTGTCGGGGAGTGGG - Intergenic
1198870878 X:141176498-141176520 AGTGGCTCCTGGCGGGGTGAGGG + Exonic
1200067305 X:153509999-153510021 AGTGTCACCTGCCAGGGGGCTGG - Intergenic
1200389250 X:155927206-155927228 ACTGGGGCCTGTCGGGGAGTGGG + Intronic
1201854539 Y:18527057-18527079 AATGGGGCCTGTCGGGGAGTAGG + Intergenic
1201878782 Y:18793328-18793350 AATGGGGCCTGTCGGGGAGTAGG - Intronic