ID: 985645227

View in Genome Browser
Species Human (GRCh38)
Location 5:1081812-1081834
Sequence CAGTGGCACCTGCCGGGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 333}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985645227_985645241 20 Left 985645227 5:1081812-1081834 CCACTCCCCGGCAGGTGCCACTG 0: 1
1: 0
2: 1
3: 27
4: 333
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37
985645227_985645236 -10 Left 985645227 5:1081812-1081834 CCACTCCCCGGCAGGTGCCACTG 0: 1
1: 0
2: 1
3: 27
4: 333
Right 985645236 5:1081825-1081847 GGTGCCACTGGTGGCCGGAGGGG 0: 1
1: 0
2: 1
3: 19
4: 311
985645227_985645238 -6 Left 985645227 5:1081812-1081834 CCACTCCCCGGCAGGTGCCACTG 0: 1
1: 0
2: 1
3: 27
4: 333
Right 985645238 5:1081829-1081851 CCACTGGTGGCCGGAGGGGAAGG 0: 1
1: 0
2: 4
3: 25
4: 340
985645227_985645239 -5 Left 985645227 5:1081812-1081834 CCACTCCCCGGCAGGTGCCACTG 0: 1
1: 0
2: 1
3: 27
4: 333
Right 985645239 5:1081830-1081852 CACTGGTGGCCGGAGGGGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985645227 Original CRISPR CAGTGGCACCTGCCGGGGAG TGG (reversed) Intronic
900682486 1:3924587-3924609 CAGGGGCACCTGCCTGGTGGGGG - Intergenic
901056002 1:6448879-6448901 CAGCGCCGCCTGCGGGGGAGCGG - Exonic
902246229 1:15122616-15122638 CAGCCCCACCTGCAGGGGAGAGG - Intergenic
902379702 1:16046911-16046933 CAGTGGCCAGTGCCAGGGAGGGG + Intronic
902742870 1:18452051-18452073 CACTGGGACCTGTCGGGGGGTGG + Intergenic
903028944 1:20448988-20449010 CAGCGGCACCAGCTGGGGAGTGG - Intergenic
904078783 1:27858940-27858962 CTGGGGCAGCTGGCGGGGAGTGG - Intergenic
905269470 1:36777729-36777751 AAGTGGCCCCTGCCTGGGAGAGG + Intergenic
905440094 1:37990156-37990178 CAGTGCCACCTGCTGGTGGGAGG + Exonic
906103686 1:43279211-43279233 TAGTGGCAGCTGCCAAGGAGTGG + Intergenic
906210917 1:44011714-44011736 AAGCGTCACCTGCAGGGGAGGGG + Exonic
906543245 1:46604188-46604210 CGCTGGCTCCCGCCGGGGAGCGG + Exonic
907891350 1:58639470-58639492 CAGTGGCCCCTGCAGTTGAGAGG - Intergenic
908286569 1:62610618-62610640 CACTGGGACCTGTCGGGGTGGGG - Intronic
909878633 1:80844701-80844723 CAGTGGGACCTGCTGGGGGAGGG - Intergenic
910523745 1:88153736-88153758 CAGTGGGGCCTGTCGAGGAGTGG + Intergenic
913058542 1:115183882-115183904 CAGGAGCACCCGCCAGGGAGGGG - Intergenic
915692175 1:157700487-157700509 CATGGGCACCGGCCGGGCAGAGG + Exonic
917192953 1:172437569-172437591 CACTGGGGCCTGCCGGGGGGTGG + Intronic
917323956 1:173812430-173812452 TAGTGGCACCTGCCTGTGTGAGG - Intronic
918829354 1:189373016-189373038 CACTGGGACCTGTTGGGGAGGGG - Intergenic
918913889 1:190609737-190609759 CACTGGGACCTGCCTTGGAGTGG + Intergenic
919764108 1:201115271-201115293 CAGGGGCGCCTGCCGGGGAGGGG + Exonic
920429227 1:205905444-205905466 CACTGGGACCTGTCGGGGGGTGG + Intergenic
920684737 1:208100887-208100909 CGCTGGCACCAGCCGTGGAGCGG - Intronic
920919251 1:210284599-210284621 CAGTGGCAGCTGCTGGGTGGTGG + Intergenic
920977492 1:210799868-210799890 CAGGGGCACCTGAGGGGGTGGGG - Intronic
921755161 1:218846878-218846900 CAGTGGGACCTGTCGGGGGCTGG + Intergenic
922339083 1:224641232-224641254 TAGCCCCACCTGCCGGGGAGGGG + Intronic
922784202 1:228275062-228275084 CAGTTGCACCTGGTGGGGAATGG + Intronic
924803206 1:247342925-247342947 GGGCGGCACCTCCCGGGGAGAGG + Intergenic
1062973053 10:1662847-1662869 CACTGGCTCCTGACGGGCAGCGG + Intronic
1066668996 10:37817105-37817127 CAGTGGCATCTACATGGGAGGGG - Intronic
1068565443 10:58569547-58569569 CACTGGGACCTGCCAGGGGGTGG - Intronic
1069630489 10:69894478-69894500 CAGGGACACCTGCCTGGGTGGGG - Intronic
1070838913 10:79469641-79469663 CACTGGGCCCTGCCTGGGAGAGG - Intergenic
1070967669 10:80539444-80539466 CTGTGGCACCTGGTGGGGACTGG - Intronic
1072424817 10:95320936-95320958 CAGTGTCACCTGCCCCAGAGAGG - Intronic
1072901243 10:99408768-99408790 CAGTGGCAACCTCTGGGGAGGGG + Intronic
1074360336 10:112820471-112820493 CAGTGGCACCTGCCAGAGGCTGG + Intergenic
1075054403 10:119207181-119207203 CACTGGCTCCTGCCGGGCCGCGG + Intergenic
1075723813 10:124601756-124601778 CAGTGGGGCCTGGCGGGGAAGGG - Intronic
1076378487 10:130009197-130009219 CAGAGCCAGCTGCCTGGGAGAGG + Intergenic
1076755849 10:132571261-132571283 CAGAGGCTCCTGCCGAGCAGAGG + Intronic
1077241571 11:1513092-1513114 CAGTGTCACCTCGTGGGGAGAGG - Intergenic
1077242238 11:1516695-1516717 GAGTGGCACCTGCCCTGTAGGGG + Intergenic
1077396405 11:2325469-2325491 CAGTGTGACATGCCGGGGAAGGG - Intergenic
1078509225 11:11973352-11973374 TAGTAGCACCTGCCCGGGACAGG + Intronic
1079198325 11:18351420-18351442 TACAGGCACCTGCCGAGGAGAGG + Intronic
1079489508 11:20972010-20972032 CACTGGGGCCTGCTGGGGAGCGG + Intronic
1079778097 11:24559959-24559981 CACTGGGACCTGTCGGGGGGTGG + Intronic
1080385948 11:31811403-31811425 CAATTGCACCAGGCGGGGAGAGG - Intronic
1080747471 11:35121162-35121184 AAATGGCACCTGCTGGGCAGAGG + Intergenic
1080977697 11:37362596-37362618 CACTGGGGCCTGTCGGGGAGTGG + Intergenic
1081043048 11:38235456-38235478 CACTGGGGCCTGTCGGGGAGTGG + Intergenic
1081570842 11:44289884-44289906 CAGTGGGTCCTGCCGGGGACAGG - Intronic
1082723658 11:56709568-56709590 CACTGGGACCTGTCAGGGAGTGG - Intergenic
1082889359 11:58122056-58122078 CACTGGGACCTGCCAGGAAGAGG + Intronic
1084045112 11:66563840-66563862 CAGCTGTACCTCCCGGGGAGGGG + Exonic
1084142564 11:67242752-67242774 CAGTGGCTCATGCCTGTGAGAGG - Intronic
1084193030 11:67507526-67507548 CTCAGGCACCTGGCGGGGAGGGG + Intronic
1084398775 11:68931742-68931764 CAGTGGCTTCTTCCAGGGAGAGG + Intronic
1084419473 11:69053168-69053190 CAGTGGCTCCTGACTAGGAGGGG - Intronic
1084683900 11:70682521-70682543 CAGTGGCCCCTTCTGGGAAGTGG + Intronic
1084989023 11:72905594-72905616 CACTGGGACCTGTCGGGGGGTGG - Intronic
1085703177 11:78763345-78763367 GAGTGGCCCCTGATGGGGAGTGG + Intronic
1087596690 11:100262774-100262796 CACTGGGGCCTGCCAGGGAGTGG + Intronic
1088595334 11:111436749-111436771 AAGGGGCACCTGCCGGGGGAGGG - Intronic
1090936732 11:131349554-131349576 CAGTGCCTCCTGCAGGAGAGTGG + Intergenic
1092028915 12:5267584-5267606 CACTGGGGCCTGTCGGGGAGTGG + Intergenic
1092217965 12:6695545-6695567 CAGTGACTCCAGCCGGGGACAGG + Exonic
1094435877 12:30420089-30420111 CAGTGGGGCCTGTTGGGGAGTGG + Intergenic
1094477570 12:30853389-30853411 CTGTGGCTGCTGCAGGGGAGGGG + Intergenic
1095681942 12:44987354-44987376 CACTGGGGCCTGTCGGGGAGTGG - Intergenic
1095690601 12:45084267-45084289 CACTGGCACCTACTGGGGGGTGG - Intergenic
1096191571 12:49623444-49623466 CGGTGGCTCCCGCCGGCGAGCGG - Exonic
1096237321 12:49938516-49938538 AAGTGGCACCTGGCGGGGGAAGG - Intergenic
1097960440 12:65527270-65527292 CAGTGGAACTTGCCAGGAAGAGG + Intergenic
1099809462 12:87562191-87562213 CAGTGGGGCCTGTCAGGGAGTGG + Intergenic
1102123308 12:110460277-110460299 CACTGGCTGCTGCCAGGGAGGGG + Intronic
1102784694 12:115594907-115594929 CAGCTGCAGCTGCCGGGCAGAGG - Intergenic
1103588090 12:121971072-121971094 CAGGGGCTCCTGCTGGGGACAGG + Intronic
1103986639 12:124771969-124771991 CAGAGGCTGCTGCCTGGGAGGGG - Intergenic
1106776672 13:33016325-33016347 CAGCGGAGCCCGCCGGGGAGCGG + Intergenic
1106817409 13:33423929-33423951 CACTGGGGCCTGTCGGGGAGTGG + Intergenic
1108378983 13:49839001-49839023 CAATGGCAGCAGCCGGGCAGTGG + Intergenic
1110199160 13:72828432-72828454 CACCGGCGCCTGTCGGGGAGTGG - Intronic
1111454830 13:88466793-88466815 CACTGGGACCTGTCGGGGTGTGG + Intergenic
1113578534 13:111411754-111411776 CAGTGGTACCTGCCGGCGCCGGG + Intergenic
1113902535 13:113804871-113804893 CAGAGGCACCTGCCATGGAGAGG - Exonic
1113982628 13:114289024-114289046 ACGTGGCTCCTGCCGGGGTGGGG + Intronic
1114424437 14:22610526-22610548 CATTGGCACATGGCGGAGAGGGG - Intronic
1116649528 14:47571739-47571761 CAGTGGGGCCTGTCGGGGGGCGG + Intronic
1118385998 14:65256043-65256065 CAGTGCCACCTGCAGGGCTGTGG - Intergenic
1118705158 14:68473323-68473345 CAGTGGCACCTGGCAGGCTGGGG - Intronic
1119265666 14:73262138-73262160 CTGTGGCACCAGCCGGGGGCAGG + Intronic
1119407841 14:74409749-74409771 CTGGGGCAGCTGCTGGGGAGGGG + Exonic
1119804652 14:77475031-77475053 CAGTGGCTCGTGGCAGGGAGTGG + Exonic
1120040538 14:79748031-79748053 CATTGGGGCCTGTCGGGGAGGGG + Intronic
1122829518 14:104389001-104389023 CAGTGGCACCCTCAGGGCAGAGG + Intergenic
1122976787 14:105174119-105174141 CAGTGGCCCAGGCTGGGGAGGGG + Intronic
1123030965 14:105450856-105450878 CAGTGTCGCCTGACGGAGAGCGG + Intronic
1124242082 15:28037176-28037198 GAGTGGGACCAGCCTGGGAGTGG + Intronic
1127286471 15:57538018-57538040 CACTGGCACCTGCCCTGGGGCGG - Intronic
1127606677 15:60593074-60593096 CACTGGGACCGTCCGGGGAGTGG + Intronic
1128498180 15:68210102-68210124 CAGAGGCACCTCCCGGGCTGAGG + Intronic
1130280575 15:82517094-82517116 CCCTTGCACCTGCTGGGGAGGGG + Intergenic
1130335146 15:82952253-82952275 CGGGGGCACCTGACGGGGACCGG - Intronic
1130471946 15:84233277-84233299 CCCTTGCACCTGCTGGGGAGGGG + Intergenic
1130479440 15:84347848-84347870 CCCTTGCACCTGCTGGGGAGGGG + Intergenic
1130492330 15:84440281-84440303 CCCTTGCACCTGCTGGGGAGGGG - Intergenic
1131156828 15:90080683-90080705 CAGGACCACCTGTCGGGGAGGGG + Exonic
1132524052 16:405546-405568 CAGTGGGACCTGCCTAGCAGGGG + Intronic
1132546312 16:534942-534964 CTGTGTCACCTGCGGGGCAGGGG + Intronic
1132589901 16:722049-722071 AAGTCGCCCCGGCCGGGGAGAGG - Intronic
1135937955 16:26797055-26797077 CACTGGCACCTGCCTGGGTTGGG - Intergenic
1136083074 16:27865429-27865451 CACTGCCACCTGGTGGGGAGTGG + Intronic
1136414492 16:30095384-30095406 CAGTGGCCCCACGCGGGGAGCGG + Exonic
1136910746 16:34142450-34142472 CAGTGGCTCACACCGGGGAGTGG + Intergenic
1138137762 16:54538270-54538292 TAGTGGCAACTTCCTGGGAGAGG + Intergenic
1138526715 16:57612734-57612756 CAGTGTCTCCTCCCTGGGAGTGG + Intronic
1140306676 16:73809338-73809360 CAGTGGCACCTCCCTGGGTCAGG - Intergenic
1140612654 16:76619536-76619558 CAGTGGTACCTGGAGGGGTGTGG + Intronic
1141699933 16:85637773-85637795 AAGCCACACCTGCCGGGGAGTGG + Intronic
1142026466 16:87816751-87816773 CAGCTGCTCCTGCCGGGAAGGGG + Intergenic
1142476601 17:192838-192860 CGGTGGCACCTGCCAGGGCTGGG + Intergenic
1143286443 17:5793328-5793350 TAGTGGCAACTGCTGGTGAGAGG - Intronic
1143497054 17:7318348-7318370 GATTGTCACCTGCAGGGGAGAGG + Exonic
1143829574 17:9640401-9640423 CTGGGGCACCTGTCGGGGGGTGG - Intronic
1144686513 17:17229521-17229543 GAATGGCAGCTGCCGGGGACTGG + Intronic
1144828881 17:18121035-18121057 CAGGGGCTCCCGCCGGAGAGGGG + Exonic
1145390664 17:22453399-22453421 CAGGGACAGCTGCCGGGCAGGGG + Intergenic
1146225873 17:31065821-31065843 GATTGGCAACTGCCTGGGAGTGG + Intergenic
1146644308 17:34566961-34566983 GAGTGGCACCTGCAAGGAAGGGG - Intergenic
1148201428 17:45752486-45752508 GAGTGGCAGCTGGCGGGGGGTGG + Intergenic
1148798837 17:50210631-50210653 CAGAGCCCCCTGCCTGGGAGGGG - Intergenic
1148851033 17:50555448-50555470 GAGAGTCACCTGCCGGGGTGGGG - Intronic
1149105983 17:52965854-52965876 CACTGGAGCCTGCCGGAGAGTGG - Intergenic
1150217077 17:63476915-63476937 CAGGGGCGCGGGCCGGGGAGGGG - Intergenic
1151229253 17:72671300-72671322 CAGATGCACCTGCAGAGGAGAGG - Intronic
1151869414 17:76826348-76826370 CAGTGGCAGGTGCCCGTGAGCGG + Intergenic
1151930837 17:77230445-77230467 CAGAGGTGCCTGCCTGGGAGGGG + Intergenic
1152122067 17:78424918-78424940 GAGTGGCAGCAGCTGGGGAGTGG + Intronic
1152336851 17:79703585-79703607 CAGTGGCACCTGCAGAGCCGGGG + Intergenic
1152353378 17:79795369-79795391 CAGCAGCACCTGCCGCGCAGAGG - Exonic
1153343541 18:4002386-4002408 GGGTGGCAGCAGCCGGGGAGAGG - Intronic
1153494006 18:5678991-5679013 CAGTAGGACCTGCCTTGGAGGGG - Intergenic
1153535828 18:6100751-6100773 CATTGGCACCAGGTGGGGAGTGG + Intronic
1155444520 18:25897101-25897123 CAGTGGCACCTGCACGGGGGTGG + Intergenic
1157384038 18:47247426-47247448 CTGTGGCAGCTGCCGGGGCAGGG - Intronic
1157610509 18:48952157-48952179 CAGTGGAACCAGCCGAGCAGAGG - Intergenic
1157676328 18:49571413-49571435 GAGTGGCATCTGCTGGGGTGAGG + Intronic
1158431751 18:57394767-57394789 CATTGGGGCCTGTCGGGGAGTGG - Intergenic
1160235112 18:77079303-77079325 CAGTGGCACCTGGCGGGCACTGG + Intronic
1160458599 18:79020402-79020424 GAATGGCACCTGCAGTGGAGGGG - Intergenic
1160873097 19:1285883-1285905 CCGCCGCACCCGCCGGGGAGGGG - Intergenic
1161281716 19:3449148-3449170 CACGGGCCCCTGGCGGGGAGGGG + Intronic
1163297918 19:16424328-16424350 CAGTGGCCCCTGGTGGGGTGGGG - Intronic
1164039531 19:21483073-21483095 CAGTGGCAGCTGCCGAGGGAGGG + Intronic
1164595959 19:29530690-29530712 CACTGGCACCTGCTGGAGAGCGG + Intronic
1165188489 19:34042107-34042129 CAGTGCCCCCTGCTGGTGAGTGG - Intergenic
1165434014 19:35787096-35787118 CAGTGACAGCTGGCGGGGACAGG - Intronic
1165466615 19:35978630-35978652 CAATGGCAGCTGTTGGGGAGAGG - Intergenic
1165969875 19:39618645-39618667 CACTGGGACCTGTCAGGGAGTGG - Intergenic
1168363807 19:55767206-55767228 CACTGGGACCTGTCGGGGGGCGG + Intergenic
925125284 2:1450354-1450376 CAGTGCCAGGTGCCTGGGAGAGG + Intronic
925238574 2:2300922-2300944 CAGTAGCTCCTGCAGGAGAGTGG - Intronic
925261221 2:2530193-2530215 CTGTGGCACCTGCCAGAGGGAGG - Intergenic
925325509 2:3018577-3018599 CACTGGGGCTTGCCGGGGAGTGG - Intergenic
925929267 2:8694118-8694140 CAGTGGGGGCTGGCGGGGAGTGG + Intergenic
927790178 2:26003444-26003466 CAGTGGGAACTGTCGGGGAGGGG - Intergenic
927856104 2:26528908-26528930 CAGTGGCATCTGCAGGGCAGTGG + Intronic
928595902 2:32858598-32858620 AAGTGGCACCTGGCCGGGTGCGG + Intergenic
930798687 2:55419989-55420011 CAGAGGCAGCTGCACGGGAGGGG - Intergenic
931873383 2:66485260-66485282 CAGTGGGGCCTGTCGGGGTGGGG - Intronic
931904807 2:66830995-66831017 CAGCAGCAGCTGCTGGGGAGGGG + Intergenic
934655845 2:96116551-96116573 CAGCCGCGCCTGCAGGGGAGTGG + Intergenic
935196364 2:100819304-100819326 CACGTGCCCCTGCCGGGGAGGGG + Intergenic
936042724 2:109161919-109161941 CAGTGGTGCCTCCTGGGGAGGGG + Intronic
936181798 2:110273676-110273698 CACTGGGGCCTGTCGGGGAGTGG - Intergenic
936230769 2:110698003-110698025 CACTGGGGCCTGTCGGGGAGTGG + Intergenic
936720838 2:115251087-115251109 CAGTGGTAGCTGCCAGGGATAGG + Intronic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
943500307 2:188680735-188680757 CAGTGGGGCCTGCCGTGGGGTGG - Intergenic
945006780 2:205417085-205417107 CACTGGGGCCTGCCGGGGGGTGG - Intronic
945249555 2:207752737-207752759 CAGTGGCACATGCCTGAGAGTGG + Intronic
945329140 2:208519401-208519423 CAGTGGGGCCTGTCAGGGAGTGG - Intronic
946847579 2:223873127-223873149 CACTGGGGCCTGTCGGGGAGTGG + Intronic
947155982 2:227163946-227163968 CCCCGGCACCTGCCTGGGAGGGG - Intronic
948676777 2:239601497-239601519 AAAGGGCACCTGCAGGGGAGAGG - Intergenic
949059607 2:241949333-241949355 CACTGTCACCCGCCTGGGAGAGG - Intergenic
1168877766 20:1183017-1183039 AGGTGGGACCTGTCGGGGAGAGG - Intronic
1172222733 20:33284842-33284864 CTGTGGCTCATGCCAGGGAGAGG - Intronic
1172226535 20:33309117-33309139 CCGTGGCATCTGCTGGGGAGAGG + Intronic
1173580330 20:44142521-44142543 CAGGGGGAGCTGCCCGGGAGAGG - Intronic
1173794610 20:45850557-45850579 CAGTGGCCCTTGCCTGGGAGAGG - Intronic
1173962982 20:47089351-47089373 CATTGTCCCCTGCCGGGGACGGG - Exonic
1176038010 20:63049716-63049738 CAGGGACACCTGCTGGAGAGGGG + Intergenic
1179024887 21:37671620-37671642 GACTGGCATCTGCCGGGGTGGGG + Intronic
1179504674 21:41832706-41832728 GATTTGCACCTGCCTGGGAGGGG - Intronic
1179655373 21:42841511-42841533 CTGAGGCACCTGCAGAGGAGAGG - Intergenic
1179711046 21:43263312-43263334 CACTGGCACCTGCCTGGGGGCGG + Intergenic
1180051420 21:45333216-45333238 CAGGGGCACCCGCCACGGAGAGG - Intergenic
1180064409 21:45405365-45405387 CAGGGGCACCTGCGCGGGACAGG - Intronic
1180950099 22:19717073-19717095 CACTGGCACCTGGGGAGGAGGGG - Intronic
1182111487 22:27726864-27726886 CAGTGGCCTCTGGCTGGGAGGGG + Intergenic
1182435370 22:30326559-30326581 TAGTGGTCCCTGCCTGGGAGGGG + Intronic
1182443400 22:30376876-30376898 CAGTGGCCCCTGCCCAGGACAGG - Intronic
1182475538 22:30574636-30574658 CGGCGGCACCTGGCCGGGAGCGG - Intergenic
1182521081 22:30884813-30884835 AAGTGACACCTACCGGGGGGTGG - Intronic
1182995153 22:34805347-34805369 CACTGGGACCTGTCAGGGAGTGG - Intergenic
1183365185 22:37403189-37403211 CAGGTGCACCTGCCTGGGGGTGG - Intronic
1184627926 22:45752524-45752546 CAGTGGCACCTGAGGGGTTGGGG + Intronic
1184821867 22:46915507-46915529 CAGTGGCACTAGCCCGGGTGTGG + Intronic
1184852513 22:47128466-47128488 GAGTGGCATCTTCCAGGGAGAGG + Intronic
1184881287 22:47305993-47306015 GAGTGGCAGCTGCCCAGGAGAGG - Intergenic
1185038385 22:48491047-48491069 CTGTGGCACCGAGCGGGGAGGGG + Intronic
1185065287 22:48629024-48629046 CACTCGCAGCTGCCGGGCAGAGG + Intronic
1185093964 22:48795734-48795756 CAGTGGCCAGTGTCGGGGAGGGG + Intronic
1185159148 22:49212488-49212510 CTGTGGCAGCTGTAGGGGAGAGG - Intergenic
1185221781 22:49632697-49632719 CAGCGCCACCTGCCGGGACGCGG + Intronic
1185342247 22:50296865-50296887 CAGTGACACCAGCAGGGGGGCGG + Intronic
950338981 3:12224799-12224821 CAGTGGCCCCGGCCAGGGATAGG - Intergenic
952117522 3:30200542-30200564 CACTGGGGCCTGCCGGGGGGTGG - Intergenic
954866673 3:53735544-53735566 CAGTGGCCTCTGCCCGAGAGAGG - Intronic
960198908 3:114807430-114807452 CAGCAGCAGCTGCAGGGGAGGGG - Intronic
960291674 3:115893132-115893154 CACTGGGGCCTGTCGGGGAGTGG + Intronic
960747850 3:120908927-120908949 CAGCAACAGCTGCCGGGGAGGGG - Intronic
960787164 3:121386558-121386580 CACTGGGACCTGTCGGGGGGTGG - Intronic
961375463 3:126462604-126462626 CGGTGGCACCTAGAGGGGAGAGG - Intronic
961951928 3:130758772-130758794 CAGTGGAACATGCTGTGGAGGGG - Intergenic
963168974 3:142232135-142232157 CAGGGGCCCATGCCAGGGAGGGG - Intergenic
964405677 3:156346493-156346515 GAGTGGCACCTGGTGGGAAGGGG + Intronic
964761482 3:160138446-160138468 CAGTGGGGCCTGTCGGGGGGTGG + Intergenic
964936273 3:162092352-162092374 CACTGGGACCTGTTGGGGAGTGG - Intergenic
965410643 3:168326422-168326444 CTCTAGCACCTGCCTGGGAGGGG - Intergenic
966477081 3:180361542-180361564 CAGTGGGGCCTGCCGGGGGTGGG - Intergenic
968250980 3:197213386-197213408 TAGTGGTACCTGGTGGGGAGTGG + Intronic
968522272 4:1039416-1039438 CTGTGGCACCTGGGGGGCAGAGG + Intergenic
968843189 4:3023419-3023441 CAGTGGCTCCTGCCGAGAAGAGG + Intronic
969658088 4:8509531-8509553 CACTCCCAGCTGCCGGGGAGGGG + Intergenic
972247423 4:37259844-37259866 CAGTGGCTCCTTCCCTGGAGGGG - Intronic
975408751 4:74023088-74023110 CAGTGGGGCCTGTCGGGGGGTGG + Intergenic
977332799 4:95658924-95658946 CAGTCACACCTTCTGGGGAGGGG - Intergenic
981794379 4:148579663-148579685 CAGTGGCTCATGCCTGTGAGAGG + Intergenic
983135410 4:164073481-164073503 CAGTGGGGCCTGTCAGGGAGTGG + Intronic
983533287 4:168832630-168832652 CCCTGGCAGCTGGCGGGGAGAGG + Intronic
984510721 4:180675451-180675473 TAGTGGCATCTGCTGGGGGGTGG + Intergenic
985489305 5:169923-169945 CAGAATCACCTTCCGGGGAGAGG + Intronic
985542235 5:492408-492430 GGGTGGGACCTGCGGGGGAGGGG + Intronic
985543349 5:497228-497250 GAGGGGCACCTGCGGGGCAGCGG - Intronic
985645227 5:1081812-1081834 CAGTGGCACCTGCCGGGGAGTGG - Intronic
985834051 5:2257667-2257689 CTGTGGGACCTGCCCGGAAGGGG + Intergenic
985915665 5:2917274-2917296 CCGTGGCACCAGCAGGGGAGAGG + Intergenic
987476986 5:18402535-18402557 CAGTCGCTCATGCCGGGGATTGG + Intergenic
990582119 5:57174668-57174690 CCGTGGCACTTGCCGTGGACTGG + Intronic
991100255 5:62784082-62784104 CACTGGCGCCTGTCGGGGGGTGG - Intergenic
992828242 5:80570080-80570102 CAGTGGCGGCTGCCGGGAGGAGG - Intronic
994061749 5:95486358-95486380 CAGTGGTAGCTGCAGGGCAGTGG - Intronic
994960409 5:106594820-106594842 CACTGGGACCTGTCGGGGTGGGG + Intergenic
995324203 5:110872751-110872773 AAGTGGCACCTGCTGGGAGGAGG + Intergenic
996445070 5:123538566-123538588 CACTGGGGCCTGTCGGGGAGTGG + Intronic
997395447 5:133556433-133556455 AAGTGGCTCCTGGCGGGGTGCGG + Intronic
997405045 5:133639132-133639154 CACTGGGGCCTGTCGGGGAGTGG - Intergenic
997407256 5:133660640-133660662 CAGTGGCACAGGCTGGGGAGAGG - Intergenic
1001448245 5:171804040-171804062 CAGTGGGGCCTGTCGGGGAATGG + Intergenic
1002470971 5:179435977-179435999 CTGTGGCCCATGCCTGGGAGGGG + Intergenic
1002549325 5:179975257-179975279 GAGTGGCATCTGCTGGGGTGAGG + Intronic
1002793002 6:449235-449257 CTGTGGCACCTGCCGGCGCCTGG - Intergenic
1002988616 6:2216845-2216867 CAGAGGCACCTGCCCAGGAGAGG - Intronic
1003644996 6:7907604-7907626 CAGTTTCAGCTGCCGTGGAGTGG - Intronic
1004492379 6:16129122-16129144 CAGGGGCAGCTGGCGGGCAGCGG + Exonic
1005783659 6:29219663-29219685 CACTGGGACCTGTCGGGGATAGG - Intergenic
1006552262 6:34834385-34834407 CACTGACCCCTGCCGAGGAGAGG + Exonic
1006881681 6:37345404-37345426 CACTGGCGCCTGCCGTGGGGTGG - Intergenic
1007249631 6:40487018-40487040 CAGTGTCACATACCTGGGAGGGG + Intronic
1007626892 6:43251766-43251788 CAGTGCCCCCTGCCCTGGAGAGG + Intronic
1009027972 6:58022812-58022834 CACTGGCACCTGCCGTGGGGTGG - Intergenic
1009203509 6:60774276-60774298 CACTGGCACCTGCCGTGGGGTGG - Intergenic
1011744063 6:90392087-90392109 CAGTGGCCACTCCCAGGGAGGGG - Intergenic
1013902100 6:115169226-115169248 CAGTGGGGCCTGTCGGGGGGTGG - Intergenic
1013926594 6:115480462-115480484 CAGAGGCACCTGCCTGTAAGAGG + Intergenic
1015045743 6:128774284-128774306 CACTGGGGCCTGTCGGGGAGTGG - Intergenic
1017515957 6:155155946-155155968 CAGTGGCACCTGCTAGAGAGAGG + Intronic
1018896127 6:168018814-168018836 CACAGGCTGCTGCCGGGGAGAGG - Intronic
1019390622 7:784551-784573 CAGTGGGAGCTGCAGGGGTGGGG - Intronic
1019505253 7:1387305-1387327 CACTGGTGCCAGCCGGGGAGTGG + Intergenic
1019595471 7:1856412-1856434 CAGCGGCCCCTGCCGGGGTTGGG + Intronic
1019786388 7:2980135-2980157 CAGTGCCAGGGGCCGGGGAGTGG - Intronic
1021751089 7:23800583-23800605 CAGTGGGGCCTGTTGGGGAGTGG + Intronic
1021758214 7:23876518-23876540 CACTGGGGCCTGTCGGGGAGTGG - Intergenic
1022832133 7:34078773-34078795 CAGGGGCACCTGCTGGGTAAGGG - Intronic
1023071298 7:36437155-36437177 CAGTGGTGGCTGCCAGGGAGTGG - Intronic
1024931300 7:54668017-54668039 CAGGGGCGGCTGCCGGGCAGAGG + Intergenic
1026178827 7:68021043-68021065 CAGTGGCACATGCCTGGAATAGG + Intergenic
1027165585 7:75831987-75832009 CAGTTGAACCTGCCAGGCAGAGG - Intergenic
1027879260 7:83812581-83812603 CACTGGGACCTGTCAGGGAGTGG - Intergenic
1028612367 7:92726086-92726108 CAGTGGCTCATGCTGGGGAGAGG + Intronic
1029202869 7:98850800-98850822 CAGTGGCAACTGCTGGGGCAGGG + Intronic
1029254949 7:99263271-99263293 CTGTGGCACCTGAAAGGGAGAGG + Intergenic
1029855400 7:103510474-103510496 CTGTGGGGCCTGTCGGGGAGTGG + Intronic
1029896560 7:103989873-103989895 GAGGGGCGCCCGCCGGGGAGCGG + Intergenic
1029964178 7:104721373-104721395 CACTGGGGCCTGTCGGGGAGTGG + Intronic
1030871729 7:114764400-114764422 CACTGGGACCTGTCGGGGGGTGG + Intergenic
1032397661 7:131602248-131602270 CTGTGGCACCTGCTAGGTAGGGG + Intergenic
1032416336 7:131738175-131738197 GAGGAGCACCTGCGGGGGAGGGG + Intergenic
1032752327 7:134853868-134853890 CACTGGGACCTGTCGGGGTGGGG - Intronic
1034789098 7:153951546-153951568 CAGTGGCGACTGCCAGGGGGAGG - Intronic
1035369269 7:158368699-158368721 CTGAGGGACCTGCAGGGGAGGGG - Intronic
1035375908 7:158406636-158406658 CAGTGTCACATGCCAGCGAGTGG - Intronic
1035403413 7:158583477-158583499 CAGTGGTGCCTGCCAGGGAGGGG - Intronic
1035679220 8:1475712-1475734 GAGTGGCACCTGCCGGCTTGGGG + Intergenic
1037217524 8:16475672-16475694 CAGTGGGAACTACTGGGGAGGGG - Intronic
1037796295 8:21998051-21998073 CAGTGGCAACTGAGGGAGAGGGG - Intronic
1037922247 8:22815671-22815693 CAGTGCCACCTGCCCGGGTGCGG - Intronic
1038320075 8:26517766-26517788 CAGCGGCACCTGCCCTGGAGAGG - Intronic
1039183886 8:34895300-34895322 CAGAGGCAGCGGCCGGGCAGAGG - Intergenic
1040599324 8:48869199-48869221 CAGTGGCACCAGCAGTGGACGGG + Intergenic
1042070260 8:64925480-64925502 CAGTGGGACCTGTCAGGGGGTGG - Intergenic
1047358037 8:124141767-124141789 AGGTGGCGCCTGTCGGGGAGGGG + Intergenic
1049307958 8:141917346-141917368 CACTGGGGCCTGTCGGGGAGTGG + Intergenic
1050071558 9:1820295-1820317 CAGTGGGACCTGTCAGGGGGTGG - Intergenic
1052654341 9:31335551-31335573 CAGTTGCACCTGGGAGGGAGAGG + Intergenic
1052706132 9:31995813-31995835 CACCGGGACCTGTCGGGGAGTGG + Intergenic
1053303250 9:36966459-36966481 CAGAGGCATCTGGCGGGGTGTGG - Intronic
1053856305 9:42342434-42342456 CCGGGGCACCTGCTGGGAAGTGG - Intergenic
1054757226 9:68971150-68971172 CACTGGGGCCTGTCGGGGAGTGG - Intronic
1056506456 9:87262818-87262840 CATTGGGGCCTGCTGGGGAGGGG + Intergenic
1057134838 9:92680432-92680454 CAGGGGGACCTGCCGGGAAAGGG + Intergenic
1060400315 9:123344746-123344768 CAGGGGCTGCTGCTGGGGAGAGG + Intergenic
1060434829 9:123584432-123584454 GAGTGGCACCAGTCGGGGAATGG + Intronic
1061855168 9:133437996-133438018 CAGTGCCCTCTGCAGGGGAGTGG + Intronic
1062192182 9:135253722-135253744 GAGTGGCGCCTGCTGGAGAGGGG - Intergenic
1062338452 9:136082750-136082772 CAGCCCCACCCGCCGGGGAGAGG - Intronic
1062651629 9:137580770-137580792 CGGTGCCACCTGCTGGGGTGAGG + Intergenic
1186878539 X:13841237-13841259 CGGAGGCATCTGCTGGGGAGTGG - Intronic
1186981919 X:14966141-14966163 CACTGGAACCTGTCGGGGTGGGG - Intergenic
1187414835 X:19084303-19084325 CACTGGGGCCTGTCGGGGAGGGG + Intronic
1188329243 X:28848149-28848171 CACTGGGACCTGTCGGGGATGGG + Intronic
1191061852 X:56306585-56306607 CACTGGGGCCTGTCGGGGAGTGG - Intergenic
1191175027 X:57490322-57490344 CACTGGGACCTGTCAGGGAGTGG - Intergenic
1191928110 X:66338039-66338061 CACTGGGGCCTGTCGGGGAGTGG - Intergenic
1192019053 X:67364819-67364841 CACTGGGACCTGCTGGGGGGTGG + Intergenic
1192271158 X:69580861-69580883 CACTGGGACCTGTCGGGGGGTGG + Intergenic
1192366211 X:70475731-70475753 CAGTGGTATCTTCTGGGGAGTGG + Intronic
1192503598 X:71668166-71668188 CAGTGGCGCCTTCTGGGGACGGG - Intergenic
1192510813 X:71719487-71719509 CAGCGGCACCTTCTGGGGAGGGG - Intergenic
1192515884 X:71762066-71762088 CAGCGGCACCTTCTGGGGAGGGG + Intergenic
1193600578 X:83504893-83504915 CTGTGGAACCTACCGGGTAGGGG - Intergenic
1194564961 X:95474127-95474149 CAGTGTCAACTGCAGGAGAGAGG - Intergenic
1195345621 X:103948024-103948046 CACTGGAGCCTGTCGGGGAGCGG + Intronic
1195722841 X:107883186-107883208 CACTGGGGCCTGTCGGGGAGTGG + Intronic
1196554521 X:117070883-117070905 CAGTGGCACCTGCAATGTAGTGG - Intergenic
1197484988 X:127037623-127037645 CAGTGGGGCCTGTCGGGGACGGG - Intergenic
1197791257 X:130256323-130256345 GATTGGCACCTTCCTGGGAGTGG - Intronic
1198445348 X:136708198-136708220 CACTGGGGCCTGTCGGGGAGTGG + Intronic
1198783937 X:140266989-140267011 CACTGGGGCCTGTCGGGGAGTGG - Intergenic
1198870877 X:141176497-141176519 CAGTGGCTCCTGGCGGGGTGAGG + Exonic
1199617527 X:149669623-149669645 CAGTTGAACCCGGCGGGGAGCGG + Intergenic
1199625116 X:149733626-149733648 CAGTTGAACCCGGCGGGGAGCGG - Intergenic
1199976007 X:152895308-152895330 CAGTGCCACCTCCAGGGGACTGG - Intergenic
1200389249 X:155927205-155927227 CACTGGGGCCTGTCGGGGAGTGG + Intronic