ID: 985645230

View in Genome Browser
Species Human (GRCh38)
Location 5:1081817-1081839
Sequence GCCACCAGTGGCACCTGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985645230_985645239 -10 Left 985645230 5:1081817-1081839 CCCCGGCAGGTGCCACTGGTGGC 0: 1
1: 0
2: 1
3: 13
4: 200
Right 985645239 5:1081830-1081852 CACTGGTGGCCGGAGGGGAAGGG 0: 1
1: 0
2: 1
3: 27
4: 328
985645230_985645241 15 Left 985645230 5:1081817-1081839 CCCCGGCAGGTGCCACTGGTGGC 0: 1
1: 0
2: 1
3: 13
4: 200
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985645230 Original CRISPR GCCACCAGTGGCACCTGCCG GGG (reversed) Intronic
901428977 1:9200924-9200946 GCCAACAGTGGCATCTGCCCAGG - Intergenic
901514400 1:9735264-9735286 GCCCCCACTAACACCTGCCGGGG + Intronic
902746371 1:18477226-18477248 GCCACCAGTGGGACAGGCTGAGG + Intergenic
903070760 1:20726053-20726075 GCCATCAGCAGCACCTGGCGAGG + Exonic
903240645 1:21980646-21980668 GCCACCACGGGCAGCTGCCCAGG + Intronic
903244388 1:22005269-22005291 GCCACCACGGGCAGCTGCCCAGG + Intronic
909635410 1:77811895-77811917 GCCACCACCGCCACCTGCCGAGG + Intronic
911993451 1:104732861-104732883 GCCACAAGTGGCACCTGAACAGG + Intergenic
913175263 1:116267481-116267503 GCCAACAGTAGCTCCTGCCTGGG - Intergenic
916851406 1:168707950-168707972 GTCATCAGTGGCATCTGCAGGGG + Intronic
917970050 1:180200431-180200453 CTGGCCAGTGGCACCTGCCGGGG - Exonic
918155795 1:181845359-181845381 TCCATCAGTGCCACCTGCCATGG + Intergenic
918965586 1:191343597-191343619 GCCAACAGTGGCAACTCCCTCGG - Intergenic
919856483 1:201709652-201709674 GCCACCAGGGGCCACTGCTGGGG + Intronic
920301696 1:204992773-204992795 GCCACCAGGCCCACCTGCCTTGG - Intronic
920340822 1:205274222-205274244 GCCACCAATGCCACCCCCCGTGG - Intergenic
922124884 1:222712431-222712453 GCCACCACCGCCACCCGCCGAGG + Exonic
922405197 1:225305480-225305502 GCCAGCAGTGGTACCTGAGGAGG + Intronic
922420845 1:225460376-225460398 GGTACCAGAGGCAGCTGCCGAGG - Intergenic
923092933 1:230753381-230753403 GACACCAGGGGCGCCTGCCCAGG - Intronic
1066302639 10:34110403-34110425 GACAGGAGTGGCTCCTGCCGGGG - Exonic
1067085301 10:43234959-43234981 GCCATCAGTGGCCTCTGCCCAGG - Intronic
1069675653 10:70245369-70245391 ACCACCAGTGGCTGCTGCAGAGG - Intergenic
1071526609 10:86363185-86363207 CGCACCTGTGGCGCCTGCCGCGG + Intronic
1071796955 10:89018157-89018179 GCCAGCAGTGGCAACTGGCCCGG - Intergenic
1073107135 10:101038664-101038686 CCCACCAGTCCCACCTGCAGGGG - Exonic
1073943870 10:108729606-108729628 GCCACAAGTGGAACCTGCACAGG + Intergenic
1075083063 10:119396792-119396814 GCCTCCTGTGCCACCTGCTGTGG - Intronic
1076618442 10:131771779-131771801 GGCACCAGTGGCTCCGGCCCAGG - Intergenic
1076680664 10:132169697-132169719 GCCACCTGTGTCTCCTGCAGTGG + Intronic
1077472516 11:2770662-2770684 GCCAGCAGTGGCATTTGCCATGG - Intronic
1079183098 11:18210991-18211013 GCCCCCAGGGGCAGCTGCAGAGG + Intronic
1080816985 11:35767914-35767936 GCCCCAAGTGGCAGCTGCAGTGG + Intronic
1083764929 11:64837144-64837166 GCCACCCGTGGCACCAGTCTGGG - Intronic
1083774835 11:64889277-64889299 GCCCCGATTGGCCCCTGCCGTGG - Intergenic
1084062593 11:66685957-66685979 GCCCCCAGTGTCACCCGTCGGGG - Exonic
1084263994 11:67995754-67995776 GCCACCAGGGGCACCGGGCGTGG + Exonic
1084809421 11:71603369-71603391 GCCACGAGGGGCACCGGGCGTGG - Intergenic
1085033240 11:73285398-73285420 GGCAACAGTGGCTCCTGCTGTGG - Intronic
1085051500 11:73382397-73382419 GCCACCTTTGCCACCTGCCCCGG - Intronic
1086170625 11:83832454-83832476 GCCTCCAGTGGCATCTGCATTGG - Intronic
1092454942 12:8634785-8634807 GCCATCAGTGGATCCTGCCTGGG + Intergenic
1097213064 12:57387168-57387190 GCCACCAGTGGCAACCGGCTGGG + Intronic
1098369210 12:69739129-69739151 GCCAGCACCTGCACCTGCCGCGG - Intronic
1099318238 12:81111410-81111432 GCCACCAGTGGCCTCTCCCCTGG - Intronic
1099720388 12:86354945-86354967 GCCAGCAGTGGCACCCCCCTTGG - Intronic
1102382472 12:112479097-112479119 CCCACCAGCAGCACCTGCCTAGG + Intronic
1102518279 12:113464390-113464412 CCCACCAGTCGCTCCTGCCGCGG - Intronic
1103537164 12:121641032-121641054 TCCACCATTGCCACCTGCGGGGG - Exonic
1103924567 12:124416492-124416514 GCCACCAATGCCACCTCCCAGGG + Intronic
1104118368 12:125772670-125772692 TGCATCAGTGGCACCTGCTGAGG - Intergenic
1104404826 12:128508630-128508652 GCCACCAGTGCCTCCTTCTGTGG + Intronic
1104621319 12:130314978-130315000 AACAGCAGTGGCACCTGCCTTGG - Intergenic
1104964327 12:132502248-132502270 GCCACCAGTGGGGTCTGCCAAGG - Intronic
1107189193 13:37559391-37559413 GCCACAAGTGGCACCTGAACAGG + Intergenic
1107589789 13:41890914-41890936 GCCACCAGCATCACATGCCGAGG - Intronic
1107652706 13:42560560-42560582 GCCACCAGTGGCAACTCGCTGGG + Intergenic
1107879756 13:44822621-44822643 GCCTCCACAGGCCCCTGCCGTGG + Intergenic
1108996130 13:56736354-56736376 GCCACCAGTGGCAACTCGCTGGG + Intergenic
1109158043 13:58935946-58935968 GCCACAAGTGGCTTCTGCCTTGG + Intergenic
1113460424 13:110478594-110478616 GCCACCTCTGCCACCTGCCTTGG - Intronic
1113806255 13:113111245-113111267 GCCACCAGCGGCACCTCCTCAGG + Intronic
1113902629 13:113805215-113805237 GTCACCAGGGCCACCTGGCGCGG - Intronic
1116508592 14:45715754-45715776 GCCACAAGTGGCACCTGAACAGG - Intergenic
1121417714 14:93790259-93790281 GCCTCCATGGGCACCTGCTGGGG + Intergenic
1122523389 14:102362927-102362949 GCCACAAGTGGCAGCGGGCGGGG - Intergenic
1123170769 14:106370897-106370919 CCATCCAGTGGCACCTGCCCTGG - Intergenic
1123194434 14:106603138-106603160 CCATCCAGTGGCACCTGCCCTGG - Intergenic
1123222390 14:106869471-106869493 CCATCCAGTGGCACCTGCCCTGG - Intergenic
1124061447 15:26297327-26297349 GCCACCAGTGGCAACCTGCGTGG - Intergenic
1127286476 15:57538023-57538045 GCCCACACTGGCACCTGCCCTGG - Intronic
1127916567 15:63459951-63459973 GCCAGCAGTGGCAACTCCCTAGG + Intergenic
1128944986 15:71813852-71813874 GCCACCAGGGGCTCCGGCTGGGG - Intronic
1129675850 15:77632247-77632269 GCCCCCAGGGGCACTCGCCGCGG + Intronic
1129741987 15:77993717-77993739 GCCCCCAGGGGCACCTCCCTGGG + Intronic
1129843430 15:78757423-78757445 GCCACCACTGGGACCTGCTTGGG + Intergenic
1130651375 15:85763957-85763979 GTCACCAGGGGCACCCACCGCGG + Intronic
1131329898 15:91487179-91487201 GACACCTGTGCCACCTGCCCAGG - Intergenic
1133216218 16:4294098-4294120 GCCTCCTGTGGCTCCTGCCAGGG - Intergenic
1133387285 16:5379956-5379978 GCCAACAAGGGCACCTGCCCGGG - Intergenic
1135328604 16:21543393-21543415 CCCACCAGGAGCACCTGCCCAGG - Intergenic
1135546731 16:23371654-23371676 GCCCCCCCTGGCACCTGCAGGGG + Intronic
1136510944 16:30738027-30738049 GCCTCCAGTGGCTCCTGAAGTGG - Exonic
1136516480 16:30771722-30771744 GGCCCCAGTGACACCTGCCCTGG - Intronic
1137030220 16:35517028-35517050 GCCACAAGTGGCACCTGAACAGG + Intergenic
1137658951 16:50186811-50186833 ACCTCAAGTGGCACCTGCCTTGG + Intronic
1139956341 16:70694864-70694886 GCCAACAGGAGCACCTGCAGAGG + Intronic
1140927606 16:79599258-79599280 GCCCCCAGCGCCACCGGCCGAGG + Exonic
1141464327 16:84196273-84196295 CCCACCCCTGACACCTGCCGTGG + Exonic
1141610830 16:85180268-85180290 GCAGCCAGAGGCACCTGCCCCGG - Intronic
1142017722 16:87759883-87759905 GCCACCAGCGGCACCAGCCCAGG + Intronic
1142964546 17:3572455-3572477 GGCACCAGTGGCACCTGGACAGG - Intronic
1143632250 17:8146077-8146099 CCCACCACTGGCTCCTTCCGTGG + Exonic
1149759985 17:59220486-59220508 TGCACCAGTGGCACCGGCTGGGG + Exonic
1152423613 17:80207146-80207168 CACTCCAGAGGCACCTGCCGTGG - Intronic
1152431930 17:80253073-80253095 CTCACCAGTGCCACCTGCGGGGG + Exonic
1155063293 18:22247399-22247421 GCCACCAGCTTCACCTGCCATGG - Intergenic
1156969815 18:43140487-43140509 GCCAGCAGTGGCAACTGGCTTGG + Intergenic
1160196203 18:76757883-76757905 GCCACCGGGGGCACCTGCCGTGG + Intergenic
1160556922 18:79731368-79731390 CCCAAGAGTAGCACCTGCCGTGG + Intronic
1160702452 19:514566-514588 GCCACCTGTGGTAGGTGCCGGGG - Intronic
1161088969 19:2350833-2350855 GCCACCCTTGGCACCCGCAGGGG - Intronic
1161304059 19:3557342-3557364 GCCACCAGGGACAGCGGCCGCGG + Exonic
1161936127 19:7373159-7373181 GCCACCCCTTGCACCTGCCGTGG + Intronic
1162232952 19:9282872-9282894 GCCAGCAGTGGCACCTCGCTCGG - Intergenic
1163124885 19:15239436-15239458 GCCACCAGGGGCCCCTGACAAGG - Exonic
1163183048 19:15617398-15617420 GCCTGCAGTGGGACCTGCTGTGG + Intronic
1163233704 19:16019512-16019534 CCCAGAAGTGGCACCTCCCGTGG - Intergenic
1163497658 19:17655983-17656005 GGCCCCAGTGGCACCCACCGAGG - Exonic
1164039527 19:21483068-21483090 AGCTCCAGTGGCAGCTGCCGAGG + Intronic
1165554928 19:36622305-36622327 GCCACCGGTGGCACCCGGCCAGG + Intronic
1166621826 19:44308215-44308237 GCCAGCTGTAGGACCTGCCGGGG + Intergenic
1166702106 19:44888202-44888224 GCCTCCAGGGCCACCTGCTGTGG + Exonic
1167125223 19:47544704-47544726 CCCACCACTGGCTCCTGCTGTGG - Exonic
1167725862 19:51212139-51212161 GCCACCAGTGGCCCCAGTCCTGG - Intergenic
925006573 2:447666-447688 GACACCAGTGGCATCTCCCAAGG - Intergenic
925154386 2:1638656-1638678 GACACCAGTGGCACATGGCCCGG + Intronic
925836216 2:7949654-7949676 GCCACCTTTGGCTCCTGCCTGGG - Intergenic
926081991 2:9994795-9994817 GCTACCAGGGGCACCTGGCATGG - Intronic
926159556 2:10478057-10478079 GACACCAGGGCCACCTGCAGAGG - Intergenic
929135174 2:38617057-38617079 TCCACCATTGGCCACTGCCGTGG + Intergenic
929531266 2:42754474-42754496 GCCACCAAGGGCTCGTGCCGAGG - Exonic
933777110 2:85777785-85777807 GCCTCCAGTGGAGCCTGGCGTGG + Intronic
933977985 2:87527423-87527445 GCCACCAGTGTCCCCTTCTGAGG - Intergenic
934987665 2:98899565-98899587 GCCACCAGTGCCCCCTGCTAGGG - Intronic
935659270 2:105451683-105451705 GCCTCCAGCGGCACCTGCATTGG - Intergenic
936233415 2:110724234-110724256 GGCACCAGTGGCCCATGCTGGGG - Intergenic
936315847 2:111423384-111423406 GCCACCAGTGTCCCCTTCTGAGG + Intergenic
938637213 2:133241673-133241695 CTCACCAGTGGCATCTGCAGGGG + Intronic
940140466 2:150486441-150486463 GCCACTAGTGGCTCCAACCGCGG + Intronic
943577729 2:189650993-189651015 GCCAGCAGTGGCAACTGGCTTGG + Intergenic
949058917 2:241945303-241945325 GCCAGCAGTGGCTCCTGGTGAGG - Intergenic
1169060734 20:2658843-2658865 GCCACCACCGGCAACAGCCGTGG + Intronic
1172274796 20:33673728-33673750 GCCACCATGGGCACCAGCCACGG - Intronic
1175402499 20:58708522-58708544 GCCTCCATGAGCACCTGCCGTGG + Intronic
1175412790 20:58782425-58782447 GCAACCACGGGCACCTGCAGGGG + Intergenic
1179221616 21:39412901-39412923 GCAACCAGTGGGACCTGTGGAGG + Intronic
1179642309 21:42755852-42755874 GCCATCAGTGGCCCCTGGCTTGG - Intronic
1181036315 22:20171461-20171483 GCCAGCAGTGCCACCTGCAGTGG - Intergenic
1182548680 22:31089872-31089894 GCCTCCATTGGAGCCTGCCGAGG + Exonic
1182878846 22:33715757-33715779 GCCCCCAGTTGCAACTGCAGTGG + Intronic
1183355271 22:37355452-37355474 CCCATCAGGAGCACCTGCCGTGG + Intergenic
1183416331 22:37684427-37684449 GCCACCCTTGGCACCTTCCTGGG - Intronic
1184389608 22:44195717-44195739 CCCACCTGTGGCAGCTCCCGTGG + Intronic
1184519549 22:44984801-44984823 GCCACCAGCGGGAAATGCCGAGG - Intronic
1184788038 22:46681196-46681218 GGCTCCAGTGACACCTGCCATGG - Intergenic
1185191694 22:49441199-49441221 CCGACCCGTGGCACCTGCCAGGG + Intronic
952885006 3:38006757-38006779 GCCACCAGTGGATCCTGCCTTGG - Intronic
953609051 3:44432444-44432466 GAGCCCAGTGGCACCTGCTGTGG + Intergenic
955386461 3:58484992-58485014 GCCACCAGTTTCACCAGCTGTGG - Intergenic
957079428 3:75623719-75623741 GCCACCAGGGGCACAGGGCGTGG + Intergenic
961461849 3:127055545-127055567 GCCAGCAGTGGCAACCGCCTCGG - Intergenic
966787573 3:183635474-183635496 GCCACCTGGGGCTCCCGCCGTGG - Intergenic
967473465 3:189889491-189889513 GCCCCCAGGGGCACATGCTGTGG - Intronic
968288433 3:197521562-197521584 ACTCCCAGTGTCACCTGCCGTGG + Intronic
968508979 4:987144-987166 GCCCCCGGTGGCCCCGGCCGAGG + Exonic
971308628 4:25505369-25505391 GCCACCATGGGCAGCAGCCGCGG - Intergenic
980183273 4:129428734-129428756 TGCAACAGTGGCACCTGCAGAGG - Intergenic
980988548 4:139718574-139718596 GCCACCAGGGGCACCAGCAGAGG + Exonic
984312531 4:178081055-178081077 TCTATCAGTGGCACCTGCAGAGG + Intergenic
985593067 5:775290-775312 CCCACCATGGGCACCTGCCTGGG - Intergenic
985645230 5:1081817-1081839 GCCACCAGTGGCACCTGCCGGGG - Intronic
985844880 5:2336627-2336649 ACCACCAATGCCTCCTGCCGAGG - Intergenic
988300114 5:29413005-29413027 GCCACCATTGGCATCTGGTGAGG + Intergenic
989525833 5:42453373-42453395 GCCACAACTGGTGCCTGCCGGGG - Intronic
989590995 5:43112780-43112802 GCCAGCAGTGGCAACTGGCTTGG - Intronic
992431680 5:76716314-76716336 GCCACCAGCAGCAGCCGCCGCGG - Exonic
994183312 5:96791259-96791281 GCCTCCAGTGGCACATGACAGGG + Intronic
995304717 5:110631546-110631568 GCCTCCAGTGGCAGCAGCAGTGG - Intronic
995868926 5:116724246-116724268 GCCCCCAGTGCCAGCTTCCGAGG - Intergenic
996683758 5:126257343-126257365 ACCACCATTGGCACCTTCCAGGG + Intergenic
998663000 5:144261712-144261734 CCCTCCAGTGGCACTTGCCAAGG - Intronic
999734905 5:154505885-154505907 GCTCCCAGAGGCATCTGCCGGGG - Intergenic
1000812785 5:165883548-165883570 GCCACAAGTGGCACCTGAACAGG - Intergenic
1001084018 5:168687257-168687279 GCCACCAGGGAAACCTGCTGTGG - Intronic
1002439591 5:179257423-179257445 GGCACCAGATGCACCAGCCGGGG + Intronic
1004128843 6:12899957-12899979 ACCACCAGTGGCCCCTGCCCTGG + Intronic
1005712141 6:28512619-28512641 GCCAGCAGTGGCAGCCCCCGTGG + Intronic
1007806334 6:44452112-44452134 GCCACCAGTGGCACCTCTGCCGG - Intergenic
1012058264 6:94443920-94443942 GGCAGCAGTGGCAGCTGCTGTGG - Intergenic
1012113200 6:95261825-95261847 CCCATGGGTGGCACCTGCCGGGG - Intergenic
1015327270 6:131937373-131937395 GCAACCAATGGAACCTGCCATGG - Intergenic
1017336677 6:153269031-153269053 GCCAGCAGTGGCAGCAGCTGTGG - Intergenic
1019314954 7:380045-380067 CACCCCAGAGGCACCTGCCGCGG - Intergenic
1019595467 7:1856407-1856429 GCCTCCAGCGGCCCCTGCCGGGG + Intronic
1022598992 7:31738779-31738801 GCCACCTGTGTCACCTGAAGCGG + Intergenic
1023620210 7:42064046-42064068 GCCACCAGTGTGACCTGCCATGG - Intronic
1025183024 7:56833487-56833509 GCCAGCTGTGGCACATGCCTTGG - Intergenic
1027203120 7:76075064-76075086 GCCAGCTGTGGCACATGCCTTGG - Intergenic
1035016070 7:155767304-155767326 ACCACAGGTGGCACCTGACGGGG - Intronic
1037417434 8:18667114-18667136 GCCACCAGTGGCAACTCGCTGGG - Intronic
1037991012 8:23321246-23321268 GTCACCAAGGGCACCTGCCAAGG + Intronic
1045368912 8:101501588-101501610 GCCAGCAGGGGCTGCTGCCGGGG + Intronic
1045778419 8:105834625-105834647 CCCACCAGAGGCACCTACCTTGG - Intergenic
1047862606 8:128984855-128984877 CCCATCAGTGGCCCCTGCCACGG - Intergenic
1049071264 8:140357696-140357718 GCCACCCGTGTCTCCTGCTGGGG - Intronic
1050681079 9:8112296-8112318 GTCACCAGTGTCACTTGCCAAGG + Intergenic
1052794084 9:32906717-32906739 GCCACCAGTGGCAACCTCCTCGG - Intergenic
1053225409 9:36351171-36351193 GCTTCCAGTGCCACCTGCAGTGG - Exonic
1058174717 9:101723528-101723550 GCCAGCAGTGGCAACTGGCTCGG - Intronic
1060023050 9:120148887-120148909 GCCACCTTTGGCATCTGCAGAGG + Intergenic
1060590241 9:124811705-124811727 GCCACCAGTGGCCCCGGGCAAGG - Exonic
1061309053 9:129750587-129750609 GCCCCCAGTGTCAGCGGCCGAGG + Intronic
1062019917 9:134314456-134314478 ACCACTAGTGGCACCTCCTGGGG - Intergenic
1062291346 9:135796590-135796612 ACCAGCTGTGCCACCTGCCGTGG - Intergenic
1062543304 9:137051080-137051102 GCCCCCAGTGTCCCCTTCCGTGG + Exonic
1185615545 X:1419594-1419616 CCCCCCAGTGGCACCTACCCCGG + Intronic
1185796903 X:2973066-2973088 GCCATGGGTGGCACCTGCCAAGG - Intergenic
1186647885 X:11526444-11526466 GACACCAGAAGCACCTGCTGTGG + Intronic
1187127747 X:16469909-16469931 GACACCAGGGGCCCCTGCCCTGG - Intergenic
1187326428 X:18294942-18294964 GCCCCCAGTGGCAGCTGCTGTGG - Intronic
1187596881 X:20783095-20783117 GCCAACAGTGGCTCCTGACAGGG - Intergenic
1192216349 X:69161986-69162008 GCCAGCACTGGCACCAGCCCTGG - Exonic
1197078891 X:122388581-122388603 GCCAGCAGTGGCAACTGGCTTGG - Intergenic
1199430490 X:147754034-147754056 GCCACCAGTGTCCCCAGCCAAGG + Intergenic