ID: 985645231

View in Genome Browser
Species Human (GRCh38)
Location 5:1081818-1081840
Sequence GGCCACCAGTGGCACCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 1, 2: 2, 3: 22, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985645231_985645241 14 Left 985645231 5:1081818-1081840 CCCGGCAGGTGCCACTGGTGGCC 0: 1
1: 1
2: 2
3: 22
4: 247
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985645231 Original CRISPR GGCCACCAGTGGCACCTGCC GGG (reversed) Intronic
900101432 1:963769-963791 GCCCACCAGCGGGCCCTGCCTGG + Intronic
900160726 1:1222280-1222302 GGCCAGCAGGGGCTTCTGCCTGG + Intronic
900210186 1:1451783-1451805 GGCCAGCAGTGGCCCTTGTCAGG + Intronic
900548772 1:3243218-3243240 GGCCACCCCGGGCACCTGCATGG + Intronic
900823715 1:4909833-4909855 GGCCACCCAAGGCAGCTGCCAGG - Intergenic
901004890 1:6166796-6166818 GGCCGCCAGGGGAGCCTGCCAGG + Intronic
901514399 1:9735263-9735285 GGCCCCCACTAACACCTGCCGGG + Intronic
902256389 1:15191506-15191528 GGCCCCCAGAGGCCCCTGCTGGG + Intronic
903845637 1:26278425-26278447 GCCCACACGTGGCCCCTGCCTGG - Exonic
905182266 1:36174841-36174863 GCCCCCCACTGGCTCCTGCCGGG + Intronic
908141556 1:61190197-61190219 GGCCTCTAGTGTCACCTGCCTGG - Intronic
909231638 1:73099548-73099570 AGCCACCAGAGGCAACTGACAGG + Intergenic
911615470 1:100006201-100006223 TGCCACCACTGGACCCTGCCTGG - Intronic
912692349 1:111813745-111813767 AGCCACCAGTGAGGCCTGCCTGG - Intronic
913175264 1:116267482-116267504 TGCCAACAGTAGCTCCTGCCTGG - Intergenic
913203987 1:116518656-116518678 GACCACCAGTGGGATCTGCCAGG + Intronic
913345874 1:117810684-117810706 GGCCACCAGAGGCAGCTAGCGGG - Intergenic
915076207 1:153309774-153309796 GGCCAACACTGACACCTGGCAGG + Intronic
915928375 1:160041647-160041669 GTCCACCAGTGCCACCTGTCAGG - Exonic
919856482 1:201709651-201709673 GGCCACCAGGGGCCACTGCTGGG + Intronic
920217079 1:204368547-204368569 GGCCACCTGTGGGGACTGCCTGG - Intronic
920516141 1:206585763-206585785 GGCCATGGGTGGCACCGGCCTGG - Intronic
922769838 1:228175830-228175852 GGCCAGCACTGGCAGCTTCCGGG + Exonic
922850522 1:228729970-228729992 GGCCACCAGTGGCTCCTTTCAGG - Intergenic
1063899947 10:10722089-10722111 GGCCAGGAGTGGGACCAGCCTGG + Intergenic
1067337917 10:45379346-45379368 GGCCACCAGAGGCCCGGGCCTGG - Intronic
1067434233 10:46265905-46265927 GGCCACCAGAGGCCTCTCCCAGG + Intergenic
1067439460 10:46300425-46300447 GGCCACCAGAGGCCTCTCCCAGG - Intronic
1067662963 10:48250198-48250220 GGCCACCGGTGGCTATTGCCTGG + Intronic
1067732281 10:48820803-48820825 CCCCACCTGTGGCACCTGACAGG + Intronic
1067778611 10:49180433-49180455 GGCCACCACTGACACCTGATGGG - Intronic
1069630493 10:69894484-69894506 GGCAATCAGGGACACCTGCCTGG - Intronic
1070354724 10:75628800-75628822 GGAAACCAGTGGCACATGCATGG - Intronic
1070591000 10:77800875-77800897 GCCCACCAGTGGTCCCAGCCTGG - Intronic
1070722375 10:78765516-78765538 GGCCAGCAGTGGGAACTACCTGG + Intergenic
1073107137 10:101038665-101038687 GCCCACCAGTCCCACCTGCAGGG - Exonic
1073470847 10:103721201-103721223 GTGCACCAGTAGCACCTGGCCGG + Intronic
1075040640 10:119104408-119104430 GGCCGCCTGTGGGGCCTGCCCGG + Intronic
1075730971 10:124636658-124636680 GGCCACTGGGGGCAGCTGCCAGG + Intronic
1076111369 10:127862125-127862147 TGCCATCAGTGGCAACAGCCTGG - Intergenic
1076597274 10:131631854-131631876 GGCCACCACAGGCACCTGGCTGG - Intergenic
1076597292 10:131631935-131631957 GGCCACCACAGCCACCTGGCAGG - Intergenic
1076597308 10:131632016-131632038 GGCCACCACAGGCACCTGGCTGG - Intergenic
1076597323 10:131632097-131632119 GGCCACCACAGGCACCTGGCAGG - Intergenic
1077413260 11:2413262-2413284 GGCTCCCAGAGGCGCCTGCCTGG + Intronic
1078011095 11:7573794-7573816 GGCCATAGGTGGCAGCTGCCAGG - Intronic
1079307639 11:19337758-19337780 AGCCACCATTGTCTCCTGCCAGG + Intergenic
1083256139 11:61496530-61496552 GGCCCTCAGTGGGACCTGCTGGG - Intergenic
1083271769 11:61576412-61576434 GGCCACATATGCCACCTGCCGGG + Intronic
1083603078 11:63961056-63961078 GGACACTAGTGGCTCCTGTCCGG + Intergenic
1083764930 11:64837145-64837167 TGCCACCCGTGGCACCAGTCTGG - Intronic
1088600689 11:111472023-111472045 GGCCACCATTGCCTCTTGCCCGG + Intronic
1088865150 11:113840274-113840296 GGCCACCACTGTCGCCTACCTGG + Intronic
1089511132 11:118998062-118998084 GGCTTGCAGTGGCGCCTGCCGGG + Intergenic
1092454941 12:8634784-8634806 TGCCATCAGTGGATCCTGCCTGG + Intergenic
1095200608 12:39379701-39379723 GCCCACCAATGGGACCTGGCAGG - Intronic
1095290632 12:40475625-40475647 GTCCAGCAGTGGCACCAGCACGG + Exonic
1096096521 12:48939003-48939025 GGCCACCTGTGCCACCAGCGGGG - Exonic
1096157689 12:49349734-49349756 GGCCACCAGAGCCACCGGACAGG - Intronic
1097213063 12:57387167-57387189 AGCCACCAGTGGCAACCGGCTGG + Intronic
1098273630 12:68792366-68792388 GGGCTGCAGTGGCTCCTGCCTGG + Intronic
1098580615 12:72094697-72094719 GGCCACCAGAACCATCTGCCAGG - Intronic
1101754122 12:107607683-107607705 GGCCACCAGGGGGAGCTGCTGGG - Intronic
1102051107 12:109862487-109862509 GCCCATCCATGGCACCTGCCTGG - Intronic
1103237353 12:119384599-119384621 AGCCACCAGTGGGAGCGGCCCGG - Intronic
1103924566 12:124416491-124416513 TGCCACCAATGCCACCTCCCAGG + Intronic
1103988632 12:124783878-124783900 GGCCTCCAGTGAAACCTGCAGGG + Intronic
1104611184 12:130229073-130229095 AGAGAGCAGTGGCACCTGCCAGG + Intergenic
1104652399 12:130545271-130545293 GGTCACCAGCGGCCGCTGCCTGG - Intronic
1104992489 12:132633996-132634018 GCCCTCCAGTGGAACATGCCTGG + Intronic
1106193474 13:27474153-27474175 GGCAAGCAGTGTCACCTGTCTGG - Intergenic
1106305397 13:28504770-28504792 GGCCACCAGTCCCCCCTGCCTGG + Intergenic
1106352959 13:28952018-28952040 GTGCACCAGTGGCAAATGCCTGG + Intronic
1107652705 13:42560559-42560581 GGCCACCAGTGGCAACTCGCTGG + Intergenic
1108996129 13:56736353-56736375 AGCCACCAGTGGCAACTCGCTGG + Intergenic
1113078577 13:106492665-106492687 GGCATCCTGGGGCACCTGCCAGG + Exonic
1115503831 14:34075126-34075148 AGCCAACAGTGGAACCTGCTGGG + Intronic
1117887448 14:60380214-60380236 TGGCACCAGTGGCTCCTGCCTGG + Intergenic
1119191358 14:72684382-72684404 GGCCACCCCTGGCTTCTGCCTGG - Intronic
1119396399 14:74329321-74329343 GGCCTGCAGTGGCATCTTCCAGG + Intronic
1119416116 14:74470590-74470612 GGCTCCGAGTGGCACCAGCCAGG + Intergenic
1119668940 14:76504296-76504318 GGCCACCAGAGGCACCTGGCTGG + Intergenic
1119770340 14:77216785-77216807 GGCTACCATTGTCTCCTGCCCGG + Intronic
1122232907 14:100315980-100316002 GCCCACCTGTGGCCCCAGCCTGG - Intergenic
1122630998 14:103107756-103107778 GGCCATCAGCGACACCTTCCAGG + Exonic
1122768602 14:104086993-104087015 GGCCAGGAGGGGCAGCTGCCAGG - Intronic
1122795119 14:104202156-104202178 GGCCAGCTGTGCCACCAGCCTGG - Intergenic
1122978182 14:105179573-105179595 GGCCACAGAGGGCACCTGCCTGG + Intronic
1124371421 15:29106759-29106781 GTCCATCAATGGCACCAGCCTGG + Exonic
1129054641 15:72810389-72810411 GGCTCCCAGTGGAAGCTGCCAGG + Intergenic
1129741986 15:77993716-77993738 GGCCCCCAGGGGCACCTCCCTGG + Intronic
1129843429 15:78757422-78757444 AGCCACCACTGGGACCTGCTTGG + Intergenic
1130258086 15:82335047-82335069 GGCCCCCATGGGCACCTCCCTGG + Intergenic
1130596845 15:85254916-85254938 GGCCCCCAGGGGCACCTCCCTGG - Intergenic
1131489515 15:92850354-92850376 GGCCAACAGCGGCATCGGCCTGG - Intergenic
1132461831 16:59230-59252 GGCCCACAGTGTCACTTGCCCGG + Exonic
1132701640 16:1224685-1224707 GGGCTCCAGAGGCCCCTGCCAGG + Intronic
1133216219 16:4294099-4294121 AGCCTCCTGTGGCTCCTGCCAGG - Intergenic
1133387286 16:5379957-5379979 AGCCAACAAGGGCACCTGCCCGG - Intergenic
1133998596 16:10765784-10765806 AGCCACCAGTGACAGCTGCGAGG + Intronic
1134848403 16:17460599-17460621 TGTCACCTGTGGCACCTGGCTGG - Intronic
1137403987 16:48175902-48175924 ACCCACCCATGGCACCTGCCAGG + Intronic
1137709016 16:50553847-50553869 GGGCACCAGGGCCAGCTGCCTGG + Intronic
1139375341 16:66493336-66493358 GGCCAGCAGTGCCCTCTGCCAGG - Intronic
1139552522 16:67682873-67682895 GTCCACCAGAGTCACCTGCAAGG + Intronic
1140350427 16:74257252-74257274 TGCCGCCATTGGCACCTGCTAGG - Intergenic
1141448520 16:84080475-84080497 GGCCAGAGGTGGCTCCTGCCAGG - Intronic
1142153648 16:88523553-88523575 GGCCACCAGGGTCCCCAGCCTGG - Intronic
1142695147 17:1629195-1629217 GGCCACCAGCGCCCCCAGCCGGG + Intergenic
1143358382 17:6347906-6347928 TGCCAAGAGTGGCACCTGCCTGG - Intergenic
1143509317 17:7386815-7386837 GGCCAGCAGTGGCTCCAGCAGGG - Intronic
1144391821 17:14800593-14800615 GGCCACCAGAGGTAGATGCCAGG - Intergenic
1144655496 17:17032615-17032637 GGCCACTGCTGCCACCTGCCTGG + Intergenic
1144946187 17:18970725-18970747 GGCCAACAGTGACTCCTGCTGGG + Exonic
1146671583 17:34741643-34741665 GCCCACCACAGGCACCTGCTTGG + Intergenic
1148109463 17:45136555-45136577 GGCCACCATGGGGCCCTGCCTGG + Exonic
1148463205 17:47849959-47849981 GGCTATCAGTGCCACCTCCCTGG - Intronic
1150226417 17:63527050-63527072 GCCCCGCACTGGCACCTGCCCGG + Intronic
1151698932 17:75732268-75732290 GGACACCAGTGGCCCCTGATGGG + Intronic
1152073373 17:78144986-78145008 TGCCACCTGTGGCTCCTGACCGG - Intergenic
1152080405 17:78183868-78183890 GGCCAGCTGTGGCCCCTGCAAGG + Intronic
1152270244 17:79320278-79320300 AGCCACCAGAGGGACCTCCCAGG + Intronic
1152431929 17:80253072-80253094 GCTCACCAGTGCCACCTGCGGGG + Exonic
1152519399 17:80846392-80846414 GCCCACCCCTGCCACCTGCCGGG - Intronic
1152661218 17:81543133-81543155 GGCCATCTGAGCCACCTGCCAGG + Intronic
1152676260 17:81642767-81642789 GGCCCCCAGTGGCCCCAGTCTGG + Intronic
1152879150 17:82805487-82805509 GGCCACCACTGCCACCGCCCAGG - Intronic
1153469302 18:5425872-5425894 GGGCAACAGGAGCACCTGCCAGG - Intronic
1154132971 18:11751906-11751928 GGCGACGATGGGCACCTGCCGGG - Intronic
1155469175 18:26172788-26172810 TGCCACCAATGGCACTTGGCAGG - Intronic
1157896999 18:51478803-51478825 GTTCACCAGTGTCACCTTCCAGG - Intergenic
1157953325 18:52064789-52064811 GGCCTCCACTGCCACCTCCCTGG - Intergenic
1160104883 18:75964760-75964782 GGACAGCAGTGTGACCTGCCGGG + Intergenic
1160235111 18:77079297-77079319 GGCAGGCAGTGGCACCTGGCGGG + Intronic
1160515826 18:79478703-79478725 GGCCAGAATTGGCACCTGCATGG + Intronic
1160600002 18:80005252-80005274 GGCCACCACTGGCATCTGGTGGG - Intronic
1160702453 19:514567-514589 GGCCACCTGTGGTAGGTGCCGGG - Intronic
1160873825 19:1288276-1288298 GGTGTCCAGGGGCACCTGCCCGG + Intronic
1161042481 19:2117384-2117406 GGTCACTGCTGGCACCTGCCCGG + Intronic
1161088970 19:2350834-2350856 GGCCACCCTTGGCACCCGCAGGG - Intronic
1161973595 19:7596754-7596776 GGCCATAAGTCGCAGCTGCCAGG - Intronic
1163262115 19:16197714-16197736 GGCACCCAGTGGCCGCTGCCAGG - Intronic
1163366428 19:16878383-16878405 GGCCTCCCCTGGCACCTGCTTGG - Exonic
1163569229 19:18070421-18070443 GACCACCAGTGGCGCCGGTCAGG - Intronic
1164927680 19:32143086-32143108 GGTCAGCAGTAGCACCTGCTAGG - Intergenic
1166431343 19:42730394-42730416 GCCCACCAGTTGCACATTCCAGG - Intronic
1166434465 19:42755604-42755626 GCCCACCAGTTGCACATTCCAGG - Intronic
1167315058 19:48758011-48758033 GGCCTCCCGCTGCACCTGCCAGG + Exonic
1167645673 19:50703723-50703745 GGCCAACAGTGACACCAGCATGG - Exonic
925165987 2:1716062-1716084 GTCCACCTGTGCCACCTGACTGG + Intronic
925836217 2:7949655-7949677 GGCCACCTTTGGCTCCTGCCTGG - Intergenic
926047260 2:9718677-9718699 GGCCAACAGCAGCATCTGCCTGG - Intergenic
927842406 2:26454050-26454072 ACCCACCAGTGCCACCTCCCAGG - Intronic
929171686 2:38938402-38938424 GGAGACCAGAGGCACATGCCAGG - Intronic
929607624 2:43245561-43245583 GGCCCTCATTGTCACCTGCCTGG + Intronic
929879140 2:45821440-45821462 GGCTACCTGTGGAACCTACCTGG + Intronic
932576211 2:72963714-72963736 GGCCAGCAGGGGCACCAGGCTGG - Intronic
934090414 2:88546014-88546036 AGCCACTAGTGGCTCCTGGCCGG + Intergenic
934929090 2:98405386-98405408 GGCCTCCAGTGACCACTGCCCGG - Intergenic
934987666 2:98899566-98899588 TGCCACCAGTGCCCCCTGCTAGG - Intronic
935385730 2:102498334-102498356 GGACACCAGTGTGCCCTGCCAGG - Intronic
936010234 2:108920872-108920894 GGGCACCACTGGGAGCTGCCCGG + Intronic
937262462 2:120595304-120595326 GTCCACCAGGAGCACCTGCTTGG - Intergenic
940434755 2:153638396-153638418 GGCAACCAGTGAATCCTGCCTGG - Intergenic
944608017 2:201370386-201370408 GTCCAAAAGGGGCACCTGCCAGG - Intergenic
944950598 2:204744605-204744627 GGCCACCAGTTTCATCTGACTGG - Intronic
947170961 2:227310814-227310836 GGCCTCCCCTGGCTCCTGCCTGG + Exonic
947523338 2:230864800-230864822 GGCCCGCAGTGACCCCTGCCGGG - Intronic
947542283 2:230987387-230987409 GGCCACCAGAGGGCGCTGCCGGG - Intergenic
948467214 2:238158338-238158360 CCCCACCTGTCGCACCTGCCGGG - Intergenic
948693940 2:239723298-239723320 GGCCCCCAGTGGGACCTGCAAGG - Intergenic
1171978883 20:31612962-31612984 GGCCACCAGCGCCCCCTCCCGGG + Intergenic
1172867672 20:38112617-38112639 GCCCTCCTGTGGCACCTGTCAGG + Intronic
1173008262 20:39157611-39157633 AGCCACTAGTGTCTCCTGCCTGG + Intergenic
1173384775 20:42577292-42577314 GGCCAAAACTGGCACCTGCATGG - Intronic
1175100556 20:56575901-56575923 GGCCACCATCAGCTCCTGCCTGG + Intergenic
1175175485 20:57109273-57109295 AGCCAGCAGTGGCAGCTGCGGGG + Intergenic
1175412789 20:58782424-58782446 GGCAACCACGGGCACCTGCAGGG + Intergenic
1175423198 20:58848779-58848801 ACCCACCTGTGGCACCTGCAAGG - Intronic
1175518742 20:59586084-59586106 GGCTACCAAGGGCACCTGTCAGG - Intronic
1176288944 21:5034146-5034168 TGCAGCCAGAGGCACCTGCCAGG - Intronic
1177852123 21:26360997-26361019 GGCCACAAGTGACAGGTGCCAGG - Intergenic
1179238959 21:39572185-39572207 GGCCATCAGTGGATCCTGCTAGG + Intronic
1179791820 21:43760110-43760132 GGCCAGCACCTGCACCTGCCAGG - Exonic
1179868290 21:44229458-44229480 TGCAGCCAGAGGCACCTGCCAGG + Intronic
1181696581 22:24595661-24595683 GGCTCCAAGTGGGACCTGCCAGG + Intronic
1182574202 22:31262020-31262042 GGCCACCAGTGGCCCCTAAGGGG - Intronic
1182620435 22:31615685-31615707 GGCCACCAGTACTACTTGCCTGG - Intronic
1183416332 22:37684428-37684450 AGCCACCCTTGGCACCTTCCTGG - Intronic
1183714395 22:39525307-39525329 GGCAACTTGTGGCCCCTGCCAGG + Intergenic
1184895357 22:47403480-47403502 AGCCTCCAGAGGAACCTGCCCGG - Intergenic
1185191692 22:49441198-49441220 TCCGACCCGTGGCACCTGCCAGG + Intronic
949365520 3:3276520-3276542 GGACTCCAGTGTCATCTGCCTGG - Intergenic
949928034 3:9057553-9057575 GGCCACCCGTGGCACCTGCTGGG - Intronic
950143054 3:10628335-10628357 GGCCACCATTGCCTCTTGCCTGG - Intronic
950546694 3:13642305-13642327 GGCCACCAATGGGCCCTGACAGG - Intergenic
952921132 3:38284463-38284485 GGACACCAGGGGCCCTTGCCTGG - Intronic
953615675 3:44488653-44488675 GGGCACAAGTGACACCTGTCAGG + Intergenic
953821143 3:46208495-46208517 GCCCACCAGTGGCCACTTCCTGG + Intronic
953930185 3:47002122-47002144 GCGCACCAGTGGCACCAGCCAGG - Exonic
954812715 3:53257791-53257813 GGGCAGAGGTGGCACCTGCCAGG - Intergenic
960012465 3:112848896-112848918 GGCCCCCAGTGACTCCTGCAAGG + Intergenic
960603669 3:119482906-119482928 GGCCACCGTTAGCACTTGCCTGG + Intronic
961206717 3:125088239-125088261 GGACACCCTTGGCACCTCCCAGG + Intronic
961325218 3:126105471-126105493 GGCCCCCAGTGCCTCCTGGCTGG + Intronic
962462437 3:135626994-135627016 GGCCAGCAAGGTCACCTGCCTGG + Intergenic
962580401 3:136792503-136792525 GGCCATCAGTGGCACAAGCCTGG + Intergenic
968290206 3:197533242-197533264 GGCCTCCAGTGATACCTTCCTGG + Intronic
968609720 4:1551430-1551452 GGGCACATGTGGCACCTGGCAGG + Intergenic
969857152 4:10009222-10009244 CCACACCAGAGGCACCTGCCAGG + Intronic
972287858 4:37665835-37665857 GGGCACAACTGGCACCTGTCAGG + Intronic
976281824 4:83333977-83333999 GGCCTTCAGGTGCACCTGCCTGG + Intronic
984844429 4:184097874-184097896 GGCCACCAGAGGAACCAGACCGG + Intronic
985593069 5:775291-775313 TCCCACCATGGGCACCTGCCTGG - Intergenic
985645231 5:1081818-1081840 GGCCACCAGTGGCACCTGCCGGG - Intronic
985920314 5:2966425-2966447 GGCCAACCGTGGATCCTGCCTGG - Intergenic
987970559 5:24938837-24938859 GGCCACCACTGCCATCTTCCAGG - Intergenic
991112261 5:62914278-62914300 AGTCACCTGTGTCACCTGCCTGG + Intergenic
994183311 5:96791258-96791280 TGCCTCCAGTGGCACATGACAGG + Intronic
996569555 5:124917690-124917712 GGCCAGAAGTGACACCAGCCTGG + Intergenic
996683757 5:126257342-126257364 CACCACCATTGGCACCTTCCAGG + Intergenic
1001525089 5:172423202-172423224 GGCCACCAAAGGCCCCAGCCAGG - Intronic
1002159957 5:177309211-177309233 ACCCACCAGTGGCCCCTGACAGG - Intronic
1002439590 5:179257422-179257444 GGGCACCAGATGCACCAGCCGGG + Intronic
1007049129 6:38808231-38808253 TGCCACCTGTTGCACCTGCTAGG + Intronic
1012510269 6:99993819-99993841 GTCCACCAGTCGCCCCTCCCCGG - Intronic
1017712433 6:157182561-157182583 GGCCGTCAGTGACACCTGCAGGG - Intronic
1018599542 6:165525029-165525051 GGCCTCCCGAGGCAGCTGCCAGG + Intronic
1019196093 6:170283901-170283923 CGCCAACGGGGGCACCTGCCGGG - Exonic
1019535870 7:1529781-1529803 GGACACCCATGGCATCTGCCCGG - Intergenic
1019595466 7:1856406-1856428 TGCCTCCAGCGGCCCCTGCCGGG + Intronic
1020012392 7:4813560-4813582 CCCCACCAGTGGCCCCTGCCTGG + Intronic
1023869860 7:44257353-44257375 GGCCTCCAATGACACCTGCCTGG + Intronic
1026223477 7:68420662-68420684 CGCCAACAGAGGCAACTGCCTGG + Intergenic
1026654651 7:72246468-72246490 TGCCCCCAGTGTCACCTGCCAGG + Intronic
1028727318 7:94102073-94102095 GGCCAGCAGTGGCAACCCCCTGG + Intergenic
1029248362 7:99218752-99218774 GGCCCCCAGAGGCACCTCCGTGG + Intergenic
1029732280 7:102446439-102446461 CCCCACCAGGGCCACCTGCCAGG - Intronic
1030050417 7:105532377-105532399 GGCCACCAATGTCCCCTCCCAGG - Intronic
1031667805 7:124506274-124506296 GGCAACCAGTGGCATGTGCGTGG + Intergenic
1037417435 8:18667115-18667137 AGCCACCAGTGGCAACTCGCTGG - Intronic
1037813859 8:22101881-22101903 GGACCCCAGAGGCACCAGCCTGG - Intronic
1037922250 8:22815677-22815699 GCTTACCAGTGCCACCTGCCCGG - Intronic
1039081535 8:33738698-33738720 GGCACTCTGTGGCACCTGCCTGG - Intergenic
1041172763 8:55161712-55161734 GGCCATGGGTGGCACCTGCCTGG - Intronic
1042429610 8:68689894-68689916 TTCCACCAGTGGCACCTGATAGG - Intronic
1042858316 8:73289315-73289337 GGCCATCAGTGGCCTCTGCAGGG - Intergenic
1044926551 8:97214078-97214100 GGCCATCAGAGGCAAGTGCCTGG + Intergenic
1044942824 8:97360672-97360694 GTCCTCCTGTTGCACCTGCCTGG + Intergenic
1045368911 8:101501587-101501609 GGCCAGCAGGGGCTGCTGCCGGG + Intronic
1045950611 8:107847896-107847918 GGCCTCCAGCAGCATCTGCCAGG - Intergenic
1049191864 8:141292686-141292708 GGCGGCAAGTGGCACCTGCAAGG - Intronic
1049312911 8:141942898-141942920 GGCCAGCAGGGGCTCCTCCCTGG - Intergenic
1049351030 8:142164897-142164919 CGCCCCCAGTGACACCTACCGGG - Intergenic
1049801206 8:144518192-144518214 GGCCCGCGGTGGCACCTCCCAGG - Intronic
1049872949 8:144995071-144995093 GGCCACCAGTGCCCCCAGACTGG - Intergenic
1050413473 9:5390011-5390033 TGACCCCAGTGGCACCTTCCTGG - Intronic
1056731126 9:89167521-89167543 GGGAATCAGGGGCACCTGCCAGG + Intronic
1059367551 9:113798442-113798464 GGACTTTAGTGGCACCTGCCTGG + Intergenic
1060405061 9:123368925-123368947 GGCCACCTGTGGCTCCTGGCAGG + Intronic
1061410959 9:130421453-130421475 GGCCAGGATTGGGACCTGCCAGG - Intronic
1061546509 9:131307874-131307896 GGCCATCAGGGCCACCAGCCAGG - Intronic
1185499404 X:585405-585427 GGCCACCTGTGGCACCTGCCAGG + Intergenic
1187353295 X:18542296-18542318 GGCCTCCACTGACACCAGCCTGG + Intronic
1187596882 X:20783096-20783118 AGCCAACAGTGGCTCCTGACAGG - Intergenic
1189186310 X:39058391-39058413 AGCCACCAGTATCTCCTGCCTGG - Intergenic
1189349539 X:40266540-40266562 GGCCCCCTGGGCCACCTGCCTGG - Intergenic
1190091104 X:47438190-47438212 GGCCAGCAGGAGCATCTGCCTGG + Intergenic
1194793964 X:98186989-98187011 GTTTACCAGTGTCACCTGCCGGG + Intergenic
1196339748 X:114583168-114583190 GGACACCGCAGGCACCTGCCCGG + Intergenic
1199608750 X:149596330-149596352 AGCCAACAGTGGCATCTGCGAGG + Intergenic
1199630372 X:149773030-149773052 AGCCAACAGTGGCATCTGCGAGG - Intergenic
1200122686 X:153798577-153798599 GGCCAGCAGAGGCACCAGGCAGG + Intergenic