ID: 985645232

View in Genome Browser
Species Human (GRCh38)
Location 5:1081819-1081841
Sequence CGGCCACCAGTGGCACCTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985645232_985645241 13 Left 985645232 5:1081819-1081841 CCGGCAGGTGCCACTGGTGGCCG 0: 1
1: 0
2: 1
3: 12
4: 166
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985645232 Original CRISPR CGGCCACCAGTGGCACCTGC CGG (reversed) Intronic
900093309 1:929932-929954 TGGCCAGCTGTGGCTCCTGCTGG + Intronic
902256388 1:15191505-15191527 TGGCCCCCAGAGGCCCCTGCTGG + Intronic
902782825 1:18715823-18715845 TGGCCCCTGGTGGCACCTGCTGG - Intronic
902986886 1:20160324-20160346 TGGTCATCAGTGGCACCGGCTGG - Intergenic
903816213 1:26066308-26066330 CGGCCTGCAGAGGAACCTGCTGG - Exonic
905454029 1:38075398-38075420 AGGCCACCTGTGGCCCCTCCTGG - Intergenic
905650549 1:39653695-39653717 CGGCCTGCAGTGCCACCTACTGG + Intergenic
907077725 1:51593497-51593519 CAGCCAGCAGTGGCATCTTCAGG - Intronic
916851404 1:168707948-168707970 CAGTCATCAGTGGCATCTGCAGG + Intronic
919856481 1:201709650-201709672 TGGCCACCAGGGGCCACTGCTGG + Intronic
919914891 1:202133145-202133167 CAGCCCCAAGTGGCAGCTGCTGG + Exonic
1064016003 10:11772928-11772950 CTGCCACCTGTGGAAGCTGCAGG - Intergenic
1066389694 10:34968964-34968986 AGGTCATCAGTGGCACCGGCTGG - Intergenic
1067778612 10:49180434-49180456 TGGCCACCACTGACACCTGATGG - Intronic
1068023577 10:51616178-51616200 CTGCCACCAGTGGGGCCTGCAGG - Intronic
1073030037 10:100518915-100518937 CAGTCACCAGTGCCACCTGCTGG + Intronic
1073107138 10:101038666-101038688 AGCCCACCAGTCCCACCTGCAGG - Exonic
1077410972 11:2403732-2403754 GGGCCACCGGTGCCACCTGCAGG - Exonic
1081890515 11:46538003-46538025 AGCCCAACAGTGACACCTGCTGG + Intronic
1083256140 11:61496531-61496553 GGGCCCTCAGTGGGACCTGCTGG - Intergenic
1083271768 11:61576411-61576433 CGGCCACATATGCCACCTGCCGG + Intronic
1083281112 11:61627851-61627873 TTGCCACCAGTGGGACTTGCAGG + Intergenic
1084032878 11:66491508-66491530 CAGCCACCAGGGGCAGATGCTGG + Exonic
1090124939 11:124075665-124075687 TAGCCCCCAGGGGCACCTGCAGG + Intergenic
1090662152 11:128890394-128890416 CGGTCCTCAGAGGCACCTGCCGG + Intergenic
1092388305 12:8052779-8052801 CGGCCATCAGTGCCACCTCCTGG + Exonic
1095544574 12:43350070-43350092 CTGACAACAGTGGCATCTGCTGG - Intergenic
1096096522 12:48939004-48939026 AGGCCACCTGTGCCACCAGCGGG - Exonic
1101754123 12:107607684-107607706 TGGCCACCAGGGGGAGCTGCTGG - Intronic
1102144128 12:110641755-110641777 CGCCCACCAGAGCCGCCTGCAGG - Intronic
1103537166 12:121641034-121641056 CCTCCACCATTGCCACCTGCGGG - Exonic
1103988631 12:124783877-124783899 TGGCCTCCAGTGAAACCTGCAGG + Intronic
1105432198 13:20346679-20346701 CTGCCACCAGTGATAACTGCAGG - Intergenic
1111940500 13:94601956-94601978 CGGCCACCAGCAGCACGTGAGGG - Exonic
1115503830 14:34075125-34075147 AAGCCAACAGTGGAACCTGCTGG + Intronic
1119261328 14:73239851-73239873 CGGCCCCCGGAGGAACCTGCAGG + Intronic
1119322312 14:73739324-73739346 CGGCCACCAGGTGAACCGGCAGG - Exonic
1122067582 14:99184407-99184429 AGGCCAACATTGGCACGTGCAGG - Intronic
1122994771 14:105257063-105257085 CAGCCCCCAGTGGCGCCTGCAGG - Intronic
1123028668 14:105440375-105440397 GGGCCAGCAGTGCCATCTGCCGG - Intronic
1123921665 15:25074422-25074444 CGCCTTCCTGTGGCACCTGCAGG - Intergenic
1124371638 15:29107638-29107660 CCTCCACCAGTGGCACCAGAGGG + Intronic
1124620864 15:31273143-31273165 TGGTCACCAGTGGCACCGGCTGG - Intergenic
1132806047 16:1775598-1775620 AGGCCACCAGTAGCACGTCCAGG - Exonic
1136373170 16:29848678-29848700 CGCCCTCCAGCGCCACCTGCTGG + Intergenic
1136777179 16:32878300-32878322 CAGCCAGCAGTGGAACCTTCTGG - Intergenic
1137762321 16:50950578-50950600 CGGCCACACATGGCCCCTGCAGG + Intergenic
1138319777 16:56102197-56102219 CGGCCAGCAGAGTCTCCTGCAGG + Intergenic
1140182618 16:72735885-72735907 CCTCCACCAGTGACACCTTCAGG - Intergenic
1141002306 16:80319397-80319419 CTGACAGCAGTGCCACCTGCAGG + Intergenic
1142218215 16:88840267-88840289 CGGCTGCCTGTGGCTCCTGCCGG - Intronic
1203079593 16_KI270728v1_random:1140409-1140431 CAGCCAGCAGTGGAACCTTCTGG - Intergenic
1142872265 17:2828603-2828625 GGGCCAACAGTGCCACCTGCTGG - Intronic
1143189985 17:5033943-5033965 CGCCCACCAATGGCACCTCTGGG - Exonic
1143509318 17:7386816-7386838 GGGCCAGCAGTGGCTCCAGCAGG - Intronic
1144946186 17:18970724-18970746 AGGCCAACAGTGACTCCTGCTGG + Exonic
1148872949 17:50669155-50669177 CGGCCACCAGTGCCCCTTTCGGG - Exonic
1149537412 17:57443390-57443412 CGGGCACACGTGGCACCGGCAGG + Intronic
1150223824 17:63511989-63512011 AGGCCATCTGAGGCACCTGCAGG + Intronic
1150721793 17:67619772-67619794 CTGCCCCCAGTGCCATCTGCAGG + Intronic
1151698931 17:75732267-75732289 AGGACACCAGTGGCCCCTGATGG + Intronic
1152199902 17:78939322-78939344 TGGCCACAACTGGCCCCTGCTGG - Intergenic
1152276410 17:79360391-79360413 CAGCTTCCAGTGGCACCTGTTGG - Intronic
1152431928 17:80253071-80253093 GGCTCACCAGTGCCACCTGCGGG + Exonic
1153761354 18:8335195-8335217 TGGCAACAAGTGGCTCCTGCTGG + Intronic
1158124774 18:54088910-54088932 CAGCCACCATTGGCTCTTGCGGG - Intergenic
1158669378 18:59461252-59461274 CCGCCACCACTGGCCCTTGCTGG + Intronic
1160104882 18:75964759-75964781 CGGACAGCAGTGTGACCTGCCGG + Intergenic
1160600003 18:80005253-80005275 GGGCCACCACTGGCATCTGGTGG - Intronic
1160657779 19:282142-282164 CAGCCACCAGTGCCCCCTGCAGG + Exonic
1160679763 19:407377-407399 CGGCCAGCAGGTGCACCCGCAGG + Exonic
1161088971 19:2350835-2350857 TGGCCACCCTTGGCACCCGCAGG - Intronic
1161469072 19:4447475-4447497 GGGCCACCACCGGCTCCTGCAGG + Intronic
1162398385 19:10430874-10430896 AGGCCACCAGTTGCAGCTCCGGG - Intronic
1163296794 19:16417872-16417894 GTGCCACCAGTGCCACCTGGTGG + Intronic
1163754453 19:19098240-19098262 TAGCCACCAGTGGCACCTGGAGG - Intronic
1165393398 19:35550910-35550932 CAGCCACCACTGGAACCTGAAGG + Exonic
1167308030 19:48720036-48720058 AGGCGACAGGTGGCACCTGCCGG - Intergenic
1168003124 19:53464992-53465014 TGGTCATCAGTGGCACCAGCTGG - Intergenic
925546412 2:5021713-5021735 CATCCACCAGTGGCACCTCAAGG + Intergenic
927756461 2:25712208-25712230 AGGTCATCAGTGGCACCGGCTGG + Intergenic
931249539 2:60517615-60517637 GGGCCACCTCTGGCTCCTGCTGG + Intronic
936233417 2:110724236-110724258 CAGGCACCAGTGGCCCATGCTGG - Intergenic
945704711 2:213214547-213214569 TGGACACCAGTGGGTCCTGCAGG + Intergenic
947118775 2:226797039-226797061 CGGCCTCCACTGCCACCTCCTGG + Exonic
947542284 2:230987388-230987410 CGGCCACCAGAGGGCGCTGCCGG - Intergenic
947841329 2:233209611-233209633 CTGCAGCCAGTGCCACCTGCAGG + Intergenic
948903598 2:240967753-240967775 AGGCCCCCAGTGGGAACTGCAGG - Intronic
1169227519 20:3865704-3865726 CTGCCTCCAGTGGCGCCGGCGGG - Exonic
1169488431 20:6052493-6052515 CGGCCACCTGGAGCAGCTGCAGG - Exonic
1173595625 20:44257146-44257168 CGATCACCAGCCGCACCTGCAGG - Exonic
1175170153 20:57074559-57074581 AGGCCACCAGTGTCCCCTTCAGG - Intergenic
1175175484 20:57109272-57109294 GAGCCAGCAGTGGCAGCTGCGGG + Intergenic
1175201900 20:57283783-57283805 GGTCCCCCAGTGGCACCTGAAGG + Intergenic
1175383177 20:58577510-58577532 TGGCCAGAAGAGGCACCTGCGGG - Intergenic
1175412788 20:58782423-58782445 GGGCAACCACGGGCACCTGCAGG + Intergenic
1176101595 20:63366933-63366955 AGGACACCTGTGGCAGCTGCTGG - Intronic
1177893778 21:26837737-26837759 CTGCCCCCAGTGGCAGCTGGGGG - Exonic
1178855825 21:36249774-36249796 CGGCCACATCTGGCACCTGGGGG - Intronic
1182428201 22:30285944-30285966 AGGCCACATGTGGCACATGCCGG + Intronic
1182574203 22:31262021-31262043 AGGCCACCAGTGGCCCCTAAGGG - Intronic
1183307338 22:37089690-37089712 CAGCTGCCTGTGGCACCTGCAGG - Exonic
1183347016 22:37313516-37313538 CAGCCCCCAGTGCCACCTCCAGG - Exonic
1184046640 22:41976526-41976548 AGGGGACCAGTGGCAGCTGCGGG - Intronic
1184490199 22:44803967-44803989 AGGCCACCAGACCCACCTGCAGG + Intronic
949891944 3:8739856-8739878 AGGCCCCCAGTGGGACCAGCAGG - Intronic
949928035 3:9057554-9057576 GGGCCACCCGTGGCACCTGCTGG - Intronic
950665742 3:14493769-14493791 CGGCCAGGAGTGGCACCGCCAGG + Exonic
954424501 3:50436246-50436268 CGGGCAGCAGTGCCCCCTGCTGG - Intronic
960224682 3:115156074-115156096 TGGCCACCAGTAGCCCCTGGGGG - Intergenic
963168045 3:142225181-142225203 CGGCCACCTGCAGCACCCGCGGG - Intronic
967294792 3:187954482-187954504 GGGCCACCAGAGGAACCAGCTGG + Intergenic
967760943 3:193225814-193225836 CGGGTAACAGTGGCACTTGCAGG + Intergenic
968230993 3:197004298-197004320 CCTCTTCCAGTGGCACCTGCGGG - Intronic
974626252 4:64431613-64431635 CGGCTACCAGGGGCAGATGCTGG + Intergenic
976614131 4:87058866-87058888 AGTCCACTAGTGGCTCCTGCCGG - Intronic
977013541 4:91663438-91663460 TGGCCAACAGTAGCACCTTCAGG - Intergenic
981604280 4:146526091-146526113 GGGTCATCAGTGGCACCAGCTGG - Intergenic
985645232 5:1081819-1081841 CGGCCACCAGTGGCACCTGCCGG - Intronic
992658746 5:78936627-78936649 CAGGCACCAGTGAGACCTGCAGG - Intronic
993461511 5:88188859-88188881 GGGTCATCAGTGGCACCGGCTGG + Intergenic
996811221 5:127517890-127517912 CGGCGTCCAGTGGCGCCGGCCGG - Intronic
998610543 5:143683377-143683399 CATCCACCAGTGGCTCCTCCGGG + Intergenic
999748671 5:154610505-154610527 TGGCCTCCAGCGTCACCTGCTGG + Intergenic
1000253391 5:159516019-159516041 TAGCCACCAGCGACACCTGCAGG - Intergenic
1002055770 5:176597239-176597261 CGGCGCCCAGCGACACCTGCAGG + Exonic
1002928426 6:1618368-1618390 CGGCCTGCAGTGGCAGCTGCAGG - Intergenic
1005989369 6:30893480-30893502 CAGCGTCCAGTGGGACCTGCAGG + Intronic
1007343585 6:41209592-41209614 CACTCACCTGTGGCACCTGCAGG + Intergenic
1007809448 6:44475866-44475888 GGGGCAGCAGTGACACCTGCTGG - Intergenic
1008399661 6:51049985-51050007 CCACCACAAGTGGCCCCTGCTGG + Intergenic
1010044077 6:71420439-71420461 CGGCCGGCGGTGGCACCGGCGGG + Intergenic
1010265185 6:73857689-73857711 CTGCCACAAGTGGCACATGGTGG - Intergenic
1012260654 6:97083532-97083554 CAGCCACCACAGGCACCTGGAGG - Intronic
1016941325 6:149484904-149484926 CTGACTCCAGTGGCACCTGGGGG - Exonic
1017290272 6:152727707-152727729 CTGGCAGCAGTGACACCTGCTGG - Intergenic
1017712434 6:157182562-157182584 AGGCCGTCAGTGACACCTGCAGG - Intronic
1019032467 6:169024682-169024704 CGGCCCCGAGAGCCACCTGCGGG - Intergenic
1019300957 7:303221-303243 CGGCCGCAGGTGGCACCTACAGG - Intergenic
1019595465 7:1856405-1856427 CTGCCTCCAGCGGCCCCTGCCGG + Intronic
1024533223 7:50410001-50410023 CGGGCACAACTGGAACCTGCTGG + Intergenic
1027173517 7:75889112-75889134 AGGGCAGCAGTGGCTCCTGCTGG - Intergenic
1028754446 7:94419528-94419550 CGGTCACCTGTGGCTCCAGCAGG - Exonic
1029439396 7:100578694-100578716 CTGCCGCCTGAGGCACCTGCAGG - Exonic
1031369803 7:120950946-120950968 CGGCCGCCAGTGGGACGTGCGGG + Intronic
1034279091 7:149838985-149839007 CGGACGCCAGTGGGAGCTGCAGG + Intronic
1034447830 7:151122485-151122507 CGGGCGGCAGCGGCACCTGCTGG - Intronic
1035398478 7:158550187-158550209 CGGCGGGCAGTGGCACCCGCTGG - Intronic
1035566823 8:646821-646843 CGCTCACCAGAGGCACCAGCAGG - Intronic
1035679217 8:1475705-1475727 AGAACACGAGTGGCACCTGCCGG + Intergenic
1036493484 8:9249267-9249289 GGGTCATCAGTGGCACCGGCTGG - Intergenic
1036660099 8:10702308-10702330 CAGCCCCCACTGGCATCTGCAGG + Intronic
1041564596 8:59262321-59262343 CTCTCACCAGTGGCACCTTCTGG + Intergenic
1042858317 8:73289316-73289338 GGGCCATCAGTGGCCTCTGCAGG - Intergenic
1043161552 8:76853209-76853231 CGTCCATCTGTGGCAGCTGCAGG - Exonic
1043438901 8:80259867-80259889 TGGCCACCTTGGGCACCTGCAGG + Intergenic
1045368910 8:101501586-101501608 CGGCCAGCAGGGGCTGCTGCCGG + Intronic
1048864328 8:138748484-138748506 CAGCCACCAGTGGCCCCTCAGGG - Intronic
1048957108 8:139546309-139546331 GGGTCATCAGTGGCACCGGCTGG + Intergenic
1049681994 8:143923313-143923335 CGACCACCAGAAGAACCTGCTGG - Exonic
1049759778 8:144326728-144326750 CGGCCGCCACTGCCCCCTGCCGG + Exonic
1050109093 9:2196240-2196262 CCACCACCAGTGCCACCTGAAGG + Intergenic
1050598179 9:7224877-7224899 GGGGCAGCAGTGGAACCTGCAGG + Intergenic
1055647528 9:78375200-78375222 TGGCCACCAGTAGCTCCTGATGG - Intergenic
1058635704 9:107036461-107036483 CGTCCATCACTTGCACCTGCAGG - Intergenic
1059256728 9:112937709-112937731 AGGACACCAATGGCACCTCCAGG - Intergenic
1060246448 9:121950555-121950577 AGGACCCCTGTGGCACCTGCTGG - Intronic
1060794805 9:126506456-126506478 CGGCCGCCACTGGGCCCTGCCGG + Exonic
1060999707 9:127896294-127896316 CTGCCCCCAGGGCCACCTGCAGG - Exonic
1061042811 9:128149669-128149691 GGGCCAAGAGGGGCACCTGCAGG + Intronic
1061119077 9:128632249-128632271 CGCCCAGCAGTGGGACCAGCTGG + Exonic
1061720218 9:132546741-132546763 CAGCCACCAGGGGCAGTTGCTGG - Intronic
1062497176 9:136837428-136837450 CAGTCACCAGTGGTGCCTGCAGG + Exonic
1062547153 9:137069038-137069060 TGCCCACCGGTGGCTCCTGCCGG - Intronic
1185763885 X:2708860-2708882 CCGCCACCAGTGTCACCCCCAGG - Intronic
1187670154 X:21658605-21658627 TGGCCACCAGTGTCACCAGAGGG + Intergenic
1190952500 X:55160959-55160981 CGGCCAACACTGTCACCTGCAGG + Intronic
1193162279 X:78241171-78241193 TGGCCACCAGTGGCAGAGGCAGG - Intergenic
1195536521 X:106014210-106014232 GGCCCACGTGTGGCACCTGCTGG + Intergenic
1200066115 X:153504826-153504848 CGGCTGCCACTGCCACCTGCGGG + Exonic