ID: 985645237

View in Genome Browser
Species Human (GRCh38)
Location 5:1081829-1081851
Sequence CCTTCCCCTCCGGCCACCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 310}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985645237_985645241 3 Left 985645237 5:1081829-1081851 CCACTGGTGGCCGGAGGGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 310
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985645237 Original CRISPR CCTTCCCCTCCGGCCACCAG TGG (reversed) Intronic
900010649 1:104013-104035 CCTTCCCCTTCTGCCATGAGTGG + Intergenic
900036548 1:414482-414504 CCTTCCCCTTCTGCCATGAGTGG + Intergenic
900058177 1:650236-650258 CCTTCCCCTTCTGCCATGAGTGG + Intergenic
900290448 1:1921515-1921537 CCCTCCCCTCCACCCAGCAGGGG - Intergenic
900379480 1:2376721-2376743 CCCTCCCACCCGGACACCAGCGG - Intronic
900667178 1:3823379-3823401 CCGTGCCCTCGGGTCACCAGGGG - Intronic
900786269 1:4652776-4652798 CCTTCCCCGCCGGCCGCCATAGG + Intergenic
901433933 1:9234856-9234878 CCTTCCCCTGCGGCCGCCGCGGG + Exonic
901511961 1:9721955-9721977 CCCTCCCATCTGCCCACCAGGGG + Exonic
902555431 1:17244075-17244097 CCTTCTCCTCCAGGCAGCAGCGG - Exonic
902573747 1:17363587-17363609 CCTTCTCCTCCAGGCAGCAGCGG - Exonic
902616023 1:17624064-17624086 CCTTCTCCTCCCTCCACCTGTGG + Intronic
903179111 1:21596622-21596644 CCTGCCCCTCAGCCCACCTGGGG + Intronic
904063104 1:27726299-27726321 CGTGCCCCGCCGGCCCCCAGCGG - Intronic
905437705 1:37969246-37969268 CCTTCAGCTCTGGACACCAGTGG + Intronic
906147079 1:43566520-43566542 CCTTCCCCCACGGGCACCCGCGG - Intronic
910820254 1:91338064-91338086 CCTTCCCCAGGAGCCACCAGGGG - Intronic
913027223 1:114855411-114855433 CCTTCCCCTCCCGCCCCCCCGGG + Intronic
914423844 1:147556011-147556033 CATGCCCTTCCTGCCACCAGTGG - Intronic
915505991 1:156356907-156356929 CCCTTCCCGTCGGCCACCAGGGG + Intronic
915555841 1:156660234-156660256 CCTTCCCCTCCCGCCTCCTCAGG - Intergenic
916165700 1:161965283-161965305 CTTTGCCCTCCTGCCACCAGGGG - Intergenic
916536621 1:165709547-165709569 CCTTCCCCTCGTGCCTCCAGAGG + Intergenic
917405828 1:174707778-174707800 CCTTCCCCTCCATCACCCAGTGG + Intronic
919728486 1:200898600-200898622 CCTCCCCCTCCTCCCAGCAGAGG - Intronic
919755347 1:201062810-201062832 CCATCCCCTCAGCCCATCAGGGG - Intronic
920105549 1:203550594-203550616 CCTTCCATTCCGGCCAGCTGTGG + Intergenic
920409668 1:205749648-205749670 CCTCCCCCTCCGGCCGCTGGCGG + Intronic
920515704 1:206583487-206583509 CCCTTTCCTCCGGCCTCCAGAGG + Intronic
922259089 1:223920020-223920042 CCTTCCCCTTCTGCCATGAGTGG + Intergenic
922728487 1:227937701-227937723 CCCTCCCCTCAAGCCTCCAGAGG + Intronic
922747079 1:228050421-228050443 CCTTTCCCTTCTGCCACAAGTGG + Intronic
922768776 1:228170815-228170837 CCTCCTCCCCAGGCCACCAGAGG - Intronic
922824939 1:228511454-228511476 CCTTTCCCTCCTTACACCAGTGG - Intergenic
922902857 1:229150804-229150826 CCTTCCCCTCAGGCCATCTCTGG - Intergenic
924340279 1:243022770-243022792 CCTTCCCCTTCTGCCATGAGTGG + Intergenic
924524741 1:244835784-244835806 CCTTACCCACCGCCCACCCGCGG - Intronic
1064816621 10:19272680-19272702 CCTTGCCCTCCACCCACCACAGG + Intronic
1065342759 10:24722972-24722994 CCTTCCCCTGTGGCCACCTAGGG + Intronic
1065343076 10:24723975-24723997 CCTTCCCCTCCCCTCCCCAGGGG + Intergenic
1065972430 10:30816193-30816215 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
1066224670 10:33370533-33370555 CCTTCCCCTTCCGCCATGAGTGG - Intergenic
1066650447 10:37650330-37650352 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
1066736220 10:38482836-38482858 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
1067151874 10:43742566-43742588 CCTTCACCTCCCACCATCAGTGG - Intergenic
1067662128 10:48244058-48244080 CCTTCCCCTCCCGGCCCCCGGGG + Intronic
1067944032 10:50679343-50679365 CCATCCTCTTCTGCCACCAGAGG - Intergenic
1069916271 10:71789149-71789171 CCTTCCCCTCCCGCACCCACTGG - Intronic
1070000814 10:72375749-72375771 GTTTCCCCTCCGGGCTCCAGAGG + Intronic
1072443610 10:95478950-95478972 CCTTCCCCTCCTGCCAGCAGTGG - Intronic
1074140948 10:110672250-110672272 GCGACCTCTCCGGCCACCAGGGG - Intronic
1075427886 10:122356071-122356093 CCTTGCCATCTGGCCATCAGAGG - Intergenic
1075731404 10:124638825-124638847 CCTTCCACACCCACCACCAGCGG - Intronic
1076853141 10:133102919-133102941 CCTTCTCACCAGGCCACCAGGGG + Intronic
1078048033 11:7935855-7935877 CCTTCCCCTTCAGCCATAAGTGG + Intergenic
1079034354 11:17009276-17009298 TCTTCCCCTCCTGCCTCCAGGGG + Intronic
1079498740 11:21076881-21076903 CCTTCCCCTCCTGCCATGAGTGG + Intronic
1080365040 11:31564521-31564543 CCTTCCCCTCCTGCTACCCCAGG + Intronic
1081860885 11:46332880-46332902 CCCTCCCCTCCGGACCCCACCGG + Intergenic
1081988800 11:47326527-47326549 CTTTCTCCTCCGGCCAGGAGCGG + Intronic
1082979042 11:59103378-59103400 CATTCCCCTCCAGACTCCAGAGG - Intergenic
1084225031 11:67710649-67710671 CCCTCTCCTCTGGCCACAAGAGG + Intergenic
1085068371 11:73518952-73518974 CCTTCCCCTTCTGCCATGAGTGG + Intronic
1085251109 11:75144608-75144630 GCTTCCTCTCCAGCCCCCAGGGG + Intronic
1087155486 11:94897608-94897630 TCTTGCCCTCCAGCCATCAGAGG - Intergenic
1087276631 11:96167390-96167412 CCTTCCACACTGGCCCCCAGAGG + Intronic
1087508637 11:99061182-99061204 CCTCTCCCTCCGGCCATCAAAGG - Intronic
1089304412 11:117517647-117517669 CCTACCCCCACGGCAACCAGGGG + Intronic
1089381796 11:118038180-118038202 CCTGCCCCCTCGGCCTCCAGGGG - Intergenic
1089697896 11:120227020-120227042 CCCTTCCCTCCGCCCAGCAGCGG - Intronic
1091628194 12:2138692-2138714 CCTTCCCCTTCTGCCATGAGTGG + Intronic
1095875821 12:47079567-47079589 CCTTTCCCTCCGGCTCCCGGCGG + Exonic
1096691004 12:53321683-53321705 GCTCCCCCTCCGGCCGCCAGGGG - Intronic
1097357698 12:58620668-58620690 CCTTCACTTTCTGCCACCAGTGG + Intronic
1098158998 12:67629985-67630007 CCTTCCCCTTCTGCCACGATTGG - Intergenic
1099315482 12:81078102-81078124 TCATCTCCTCCGGCCACCCGCGG - Exonic
1099318242 12:81111422-81111444 CCTGCCCAGCCTGCCACCAGTGG - Intronic
1102578398 12:113871864-113871886 CCTTGCCCTCCGGCCCCGCGGGG - Intronic
1102627354 12:114245761-114245783 CTTCCCCCTCCGGCCTACAGCGG - Intergenic
1104442093 12:128802121-128802143 CCTTCCACTCCGCCCTCCACGGG + Intronic
1104861955 12:131928768-131928790 CCTCCGCCTCCGGGCTCCAGCGG - Intergenic
1105821887 13:24087350-24087372 CCTTGCCCTCCCTCCCCCAGGGG + Intronic
1105885482 13:24638020-24638042 CGTTCGCCTCTGGCCCCCAGCGG + Intergenic
1106208722 13:27621702-27621724 CCTGCCCCTCCCGCCGCGAGTGG + Exonic
1106455278 13:29921378-29921400 TCTCCTCCTCCTGCCACCAGTGG + Intergenic
1107800500 13:44103690-44103712 CCCTCCCCTCCGGCCACAATTGG + Intergenic
1109569258 13:64164609-64164631 CCTTTCCCTCACGCCACCATCGG - Intergenic
1110607436 13:77448982-77449004 CCTTCACCTCCTGCCACGAGAGG + Intergenic
1110707250 13:78609459-78609481 CCTTCCCCTCTAGCCCCCACCGG - Intergenic
1110860872 13:80343012-80343034 GCGGCCCCTCTGGCCACCAGGGG + Intergenic
1113539430 13:111094991-111095013 CCTTCACCTGTGGCCTCCAGTGG - Intergenic
1113647543 13:112009723-112009745 CCTTGCCCTCCAGCCACGCGAGG + Intergenic
1115320763 14:32077167-32077189 CCCTCCCTCCCCGCCACCAGCGG - Intronic
1115469690 14:33755830-33755852 CCTTTCCCTTCTGCCACGAGTGG - Intronic
1118839459 14:69500093-69500115 CCTTCCCCACCGCCCACTATAGG + Exonic
1119106868 14:71932802-71932824 ACTTCCCCTCCGCCCCCAAGAGG + Exonic
1119731987 14:76956849-76956871 CCTTCCCTTCCCTCCAGCAGGGG + Intergenic
1122449769 14:101796492-101796514 CCTTGCCCTCAGGGAACCAGCGG + Intronic
1128980174 15:72180037-72180059 TCTTCTCCTCCCTCCACCAGAGG + Intronic
1129188080 15:73922697-73922719 CCCTCCCCTACGGCTCCCAGGGG - Intergenic
1129301622 15:74628870-74628892 TCTTCCCCACCTCCCACCAGAGG + Intronic
1130407294 15:83613219-83613241 CCTGGCCCTCCAGCCACCACTGG - Intronic
1132115995 15:99136976-99136998 CCCTCCCCTCCAGCCCCCAGTGG - Exonic
1133335336 16:5003447-5003469 CCTTCACCCCCGGCCGCCACAGG - Exonic
1133465101 16:6020458-6020480 TCTTCCCCTCCTCCCACAAGGGG - Intronic
1136092413 16:27929894-27929916 CCTTCCTCTCCTGCCAGCATGGG + Intronic
1136344268 16:29664851-29664873 CCATCCTCACTGGCCACCAGTGG - Exonic
1137265156 16:46862794-46862816 CCTTCCCCTTCAGCCATGAGTGG - Intergenic
1137791160 16:51175956-51175978 CCTTCCCCTTCTGCCATGAGTGG + Intergenic
1138006546 16:53342844-53342866 CCTTCCTCTCCCGCCATCTGAGG - Intergenic
1138134938 16:54513283-54513305 CCTTCCCCACCTACCACCAGTGG + Intergenic
1138168039 16:54820918-54820940 CCCACCCCTCCAGCCAGCAGTGG - Intergenic
1139928832 16:70508586-70508608 CCTTCCCTTCAAGCCAGCAGTGG + Intronic
1140125891 16:72118752-72118774 CCTGCCCCCCCGCCCACCACCGG - Intronic
1140350475 16:74257629-74257651 CCCTCCCCTCCAGCCACAATGGG - Intergenic
1140353953 16:74288292-74288314 CCTCCTCCTCCTGCCACCTGTGG + Intergenic
1140582512 16:76248277-76248299 CCTTCCCCTTCTGCCATGAGTGG + Intergenic
1141100821 16:81196337-81196359 CCTTCCACTCCCGCCACCCCTGG + Intergenic
1141268226 16:82516335-82516357 CCTTCCCCTCCGGGAAGCATTGG + Intergenic
1141455194 16:84136594-84136616 CCTCCCACTCAGGCCAGCAGAGG + Intronic
1141637504 16:85322290-85322312 CCTTCCCCCCCGCCCGCCCGGGG - Intergenic
1141638245 16:85326988-85327010 CCTGCCCCACAGGGCACCAGGGG + Intergenic
1142052340 16:87966979-87967001 CCTTCCACGCCTGGCACCAGCGG + Intronic
1142453697 16:90202896-90202918 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
1143034590 17:3987144-3987166 CCTTCCCCTTCGGCCAGTGGCGG + Intergenic
1143472496 17:7184732-7184754 CCTTCTCCTCTGTTCACCAGCGG - Intergenic
1143891717 17:10107407-10107429 CCTTCCCAGCCTGCCACCACTGG - Intronic
1144671778 17:17136858-17136880 CCTTCCCCTCCTTCTGCCAGGGG - Intronic
1145212031 17:21020962-21020984 CCTTCCCCTAAGGCCCACAGTGG - Intronic
1145276127 17:21431909-21431931 CCTTCCCCTTCTGCCACGAGTGG + Intergenic
1145313971 17:21717823-21717845 CCTTCCCCTTCTGCCACGAGTGG + Intergenic
1145712417 17:26989800-26989822 CCTTTCCCTTCTGCCACGAGTGG + Intergenic
1145965321 17:28912803-28912825 CCGGCCCCTCACGCCACCAGCGG - Exonic
1146661539 17:34668145-34668167 CCTTCCCCTCCGATCCCCAGAGG + Intergenic
1147216247 17:38900823-38900845 CCTTCCCCTCCAACTTCCAGAGG + Intronic
1147644377 17:42025072-42025094 CCGCTCCCTCCAGCCACCAGGGG + Exonic
1148225180 17:45894414-45894436 CCTTCTCCTCCGGCCACTAGTGG - Exonic
1148695637 17:49556506-49556528 CCTCCGCCTCTGGCCAACAGAGG - Intergenic
1150138054 17:62706658-62706680 CCTGCCCCTCCGGCCAGCCCCGG + Intronic
1150280035 17:63924572-63924594 CCTTCCCCTCCTGCCACATGGGG + Intergenic
1150777710 17:68094876-68094898 CCTTCTTCTGCAGCCACCAGTGG + Intergenic
1151483378 17:74383520-74383542 CCTTCCCTTCCGACCACCTCTGG - Intergenic
1151712463 17:75814594-75814616 CCTTGCCCTCTGGCCCCAAGAGG + Intronic
1152216440 17:79035334-79035356 CCATCCCCTCCAGCCACCTTTGG - Intronic
1152366997 17:79862162-79862184 CCTTCCCCTCTGGCCACGGCTGG - Intergenic
1152702305 17:81825165-81825187 CCACCCCCTCTGCCCACCAGGGG - Exonic
1154218515 18:12432928-12432950 CCTGCCCCGCCGGCCAGAAGCGG + Intergenic
1155284272 18:24272065-24272087 CCTGCGCCTCCGCCCGCCAGCGG - Intronic
1156383037 18:36581366-36581388 CCTTCCCCTTGGGCCAAAAGAGG - Intronic
1158035282 18:53021091-53021113 CCTTTCCCTCAGGCCGTCAGTGG - Intronic
1158325332 18:56307723-56307745 CCTTCCCCTCCCCCCACAACGGG - Intergenic
1158962320 18:62596942-62596964 CCTCCCTCTCCGGGCACCTGTGG - Intergenic
1160006592 18:75073140-75073162 CCTTCACCTCCCACCACCAGAGG - Intergenic
1160229262 18:77034129-77034151 ACTTCCACTTCTGCCACCAGTGG - Intronic
1160689494 19:454853-454875 CCTTCCCCTGCTGCCTCCAGAGG - Intronic
1161959652 19:7516461-7516483 CCTTTCCCCCCGGGCCCCAGCGG - Intronic
1161991380 19:7686176-7686198 CCATCCCCACCGGCCACCGAGGG + Exonic
1163242009 19:16070157-16070179 CCCTCTCCTCCGTCCACCACGGG - Intronic
1163463735 19:17454743-17454765 CCAGCCCCTCCTGCCCCCAGAGG + Intronic
1163704137 19:18802628-18802650 CCTGCCCCTCCAACCTCCAGAGG - Intergenic
1163777426 19:19226632-19226654 TCTTCCCCACTGGACACCAGAGG - Exonic
1164627697 19:29740397-29740419 CCTTCCCCTTCTGCCACGAATGG + Intergenic
1164873892 19:31669606-31669628 AGGTCCCCTTCGGCCACCAGGGG + Intergenic
1164902945 19:31943505-31943527 CCTTGCTCTCTGCCCACCAGGGG - Intergenic
1165849064 19:38838652-38838674 CTTTCCCCTGTGGCCTCCAGAGG + Intronic
1165993771 19:39830821-39830843 CCTTCACCTCCGACCTCAAGAGG + Intronic
1166872092 19:45877041-45877063 CCCGCCCCTCCGGCCACCTGAGG - Intergenic
1167499268 19:49836261-49836283 CCACCACCTCCAGCCACCAGGGG + Exonic
1167672215 19:50859763-50859785 CCTTCCCCACCGGCCAGGACTGG + Intronic
1168246398 19:55114861-55114883 CCTTCCCCTGCATCCCCCAGAGG - Intronic
925400155 2:3566865-3566887 CCTTCCCCTTCTGCCATGAGTGG + Intergenic
927046315 2:19282523-19282545 CCTTCCCCTCTGGCCAGAAACGG + Intergenic
927149552 2:20187801-20187823 CCCTCCCCGCCAGCCACTAGAGG + Intergenic
927715643 2:25350456-25350478 TCTTCCCCTTCCGCCACGAGTGG + Intergenic
929903796 2:46028547-46028569 CCCTCCCCACCTGCCACCACTGG + Intronic
930004006 2:46881751-46881773 CCTGCCCCTCCTCCCACCTGAGG - Intergenic
930254290 2:49071752-49071774 CCTTCCCCTACTGCCATGAGTGG - Intronic
931250938 2:60529974-60529996 CTTTGCCCTCCTGCCACAAGTGG - Intronic
931681266 2:64751398-64751420 CCTTCCCCTCTGGCCGGCTGCGG - Intergenic
932036547 2:68252226-68252248 CCCTCCCCGCCGGCGACCCGAGG - Exonic
932144903 2:69308021-69308043 CCTTCCCCTCTGACAGCCAGTGG + Intergenic
932340959 2:70962446-70962468 CCTTCCCCTTCGGTCCACAGGGG + Intronic
932708657 2:74046763-74046785 TCTTCCCCTCCAGCCACTCGAGG - Exonic
932772279 2:74507296-74507318 ACTCCCCCTCCGCCCAGCAGAGG + Intronic
933206347 2:79512714-79512736 CCGTCCCCTCCCCCCACCTGCGG + Intronic
933252139 2:80040661-80040683 CATTCCCCACAGGCCAGCAGAGG + Intronic
935439556 2:103076193-103076215 TTTTCCCCTCCAGCCTCCAGTGG - Intergenic
935573544 2:104687204-104687226 CCTCCTCCTTCGGCCTCCAGGGG + Intergenic
937426494 2:121803919-121803941 CCTTCCCCTTCTGCCACGAGTGG + Intergenic
940132641 2:150401057-150401079 CCTTCCCCTTCTGCCATGAGTGG + Intergenic
940282769 2:152004600-152004622 CCTGCCCCTCCTGCCTTCAGTGG + Intronic
941772782 2:169362236-169362258 CTCTCCCCTCCGGCCTCCCGCGG + Intronic
942299566 2:174548679-174548701 CCTCCCCCACCGGCCTCCATGGG - Intergenic
942544743 2:177051903-177051925 GCTTCTCCTCCTGCCACCTGTGG + Intergenic
946164915 2:217858018-217858040 CATTCCCCACCGGCCTCCTGTGG - Intronic
947269517 2:228318403-228318425 CCTGTCCCTGCGGCCAGCAGAGG + Intergenic
947596468 2:231415108-231415130 ACTTCTCCTTCTGCCACCAGTGG - Intergenic
949058908 2:241945267-241945289 CCTTCACCTTCCACCACCAGAGG + Intergenic
949085143 2:242147559-242147581 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
1169130579 20:3164648-3164670 CCTTCTCCTCCAGCCACACGCGG + Exonic
1170413496 20:16115716-16115738 ACTTCCCCACCTCCCACCAGGGG + Intergenic
1171493840 20:25540406-25540428 CCTTCTCCTCCGGCCTCCAGAGG - Intronic
1172625039 20:36342043-36342065 GGCTCCACTCCGGCCACCAGGGG - Intronic
1173615342 20:44399900-44399922 CCTGCCCTTCCAGCCAGCAGTGG + Intronic
1173704701 20:45101129-45101151 CCGCCGCCTCCGGCCGCCAGCGG - Intergenic
1175355765 20:58366233-58366255 CCTTCCCCTGCGGCCTTCCGTGG + Exonic
1175898679 20:62351440-62351462 CCTTGCCCTACTGCCAGCAGAGG - Intronic
1175900979 20:62359828-62359850 CCTGCCCCACCGCACACCAGGGG + Intronic
1175907173 20:62386683-62386705 CCTCACCCTGCGGCCACCTGGGG - Intergenic
1176415324 21:6471432-6471454 CCCAGCCTTCCGGCCACCAGGGG - Intergenic
1178155921 21:29854147-29854169 CCTTCCCCTTCTACCACAAGTGG - Intronic
1178474601 21:32926499-32926521 TCTTCACCTTCCGCCACCAGTGG - Intergenic
1179509905 21:41865553-41865575 ACTTCCCCTCAGTCCACCATGGG + Intronic
1179690824 21:43079765-43079787 CCCAGCCTTCCGGCCACCAGGGG - Intergenic
1179776324 21:43665767-43665789 CCTTCCCCTCCAGCCAAGATGGG + Intronic
1181427856 22:22855857-22855879 CCTCCCTCTGAGGCCACCAGGGG + Intronic
1181509243 22:23381714-23381736 CCCTGCCCTCGGGCCCCCAGAGG + Intergenic
1183539110 22:38419395-38419417 CCTGCCCCTCTGGCCTCCTGGGG - Intergenic
1184032699 22:41904356-41904378 CCTTGCCCTTCACCCACCAGTGG + Intronic
1184096159 22:42317638-42317660 CTTTCCCCCCCAGCCCCCAGCGG - Intronic
1184120115 22:42444582-42444604 CCTTCCTGTCCGGCCTCCAGGGG - Intergenic
950261079 3:11543831-11543853 CCTCCCCCTCCCGTCCCCAGAGG - Intronic
950307491 3:11927779-11927801 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
951906836 3:27714830-27714852 CCTTCCCCTCCGTCCCTCTGGGG - Intergenic
953846185 3:46428562-46428584 CTTTTCCCCCCGGCCCCCAGCGG + Intergenic
954389201 3:50260128-50260150 CATCCGCCTCCGGCCGCCAGGGG + Intergenic
954448294 3:50558259-50558281 GCATCCCCTCCAGCCAGCAGCGG + Exonic
954707064 3:52486799-52486821 CCTGCCCCGGAGGCCACCAGGGG + Intronic
954794403 3:53154261-53154283 CCTTCTCCTCCGGATTCCAGTGG + Intergenic
954815076 3:53273845-53273867 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
955272299 3:57513361-57513383 CCTTGCCCTCCATCCCCCAGTGG - Intronic
956739735 3:72266492-72266514 CCTTCCCAGCCTGCCTCCAGAGG - Intergenic
957078287 3:75618434-75618456 CCCTCTCCTCTGGCCACAAGAGG + Intergenic
958860062 3:99435662-99435684 CCTTCCCCTTCTTCCACGAGTGG + Intergenic
959519097 3:107305718-107305740 CCCTCCCCTGGGGCCATCAGAGG - Intergenic
960523361 3:118681256-118681278 CCTTCCCCTTCCCCCACGAGTGG + Intergenic
960947278 3:122975256-122975278 CCTTTCCCGCCAGCCAGCAGCGG - Intronic
963031933 3:140987364-140987386 CCTTCCCCTTCGACCACAACTGG + Intergenic
963538493 3:146557966-146557988 TCTTCCCCTTCTGCCACGAGTGG + Intergenic
966155644 3:176913433-176913455 CCTTCACCTCCGGGCTCAAGTGG - Intergenic
966205111 3:177398263-177398285 CCTTTCCCTTCGGCCATGAGTGG - Intergenic
969021357 4:4142407-4142429 CCCTCTCCTCTGGCCACAAGAGG + Intergenic
969044623 4:4327851-4327873 CCTTCCCCTTCGACCCCCAGGGG + Intergenic
969312097 4:6359645-6359667 CCTTCATCTCCTGCTACCAGAGG + Intronic
969399330 4:6943491-6943513 CCTGCATCTCTGGCCACCAGTGG + Intronic
969415274 4:7053716-7053738 CATTCCCCACCTGCGACCAGAGG - Intronic
971135160 4:23860309-23860331 CCTTCCCCTCCCCCCACCCCTGG - Intronic
972221892 4:36965457-36965479 CCTTCCCTTCCCACCACCACTGG + Intergenic
973789380 4:54364211-54364233 CCTTCCCCTCCCGATCCCAGAGG - Intergenic
976706054 4:88020460-88020482 CCCTCCCCTCCCCCTACCAGAGG - Intronic
979262574 4:118665804-118665826 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
980966274 4:139524440-139524462 TCTGTCCCTCCGGCCTCCAGTGG - Intronic
981339479 4:143604174-143604196 CCTTCCCCTTCTGCCAGGAGTGG + Intronic
981353907 4:143765168-143765190 CTTTCCCCTTCTGCCACCATTGG - Intergenic
982364806 4:154565874-154565896 CCTGCCCCACCGCCCATCAGTGG + Exonic
983388083 4:167091970-167091992 CCTGCTCCTCCTTCCACCAGGGG + Intronic
984324399 4:178233681-178233703 CCCTCCCCTCCCTCCACCACAGG + Intergenic
985645237 5:1081829-1081851 CCTTCCCCTCCGGCCACCAGTGG - Intronic
987062502 5:14256153-14256175 CCTTCACCTTCAGCCACAAGTGG - Intronic
990926959 5:61036871-61036893 CCTTGCCCTCTGGCTTCCAGTGG - Intronic
993631791 5:90294762-90294784 CTTTCCCCTCCGCCCAGTAGGGG + Intergenic
994065942 5:95542411-95542433 CCTGCCTCCCCCGCCACCAGTGG - Intronic
995547979 5:113251881-113251903 ATGTCCCCTCAGGCCACCAGTGG - Intronic
997585648 5:135041426-135041448 CCTTCCACTCCAAGCACCAGGGG + Intronic
998018753 5:138753140-138753162 CCTTCCTCCCCGGCCCCTAGTGG - Intronic
998594495 5:143514610-143514632 CCTTCTCCTCCAGCCTCCATGGG - Intergenic
999314329 5:150574382-150574404 CCTTCTCCTCGGGCCTTCAGTGG - Intergenic
1000143334 5:158428367-158428389 TGTTCCCCACCTGCCACCAGAGG + Intergenic
1000263747 5:159615315-159615337 CCTCCCCCTCCCGCCTCTAGAGG + Intergenic
1001300849 5:170532706-170532728 CCTGCCCCCCATGCCACCAGAGG + Intronic
1002301885 5:178262030-178262052 CCTGCCCCTCCAGCCACCCTGGG - Intronic
1002737273 5:181404382-181404404 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
1003667117 6:8121710-8121732 CCTTCACCTTCTGCCACCAGTGG + Intergenic
1003682707 6:8271772-8271794 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
1003754542 6:9102029-9102051 CCTTCCCCTTCTGCCTCGAGTGG - Intergenic
1006003161 6:30982512-30982534 CCTTCTCCTTCGGCCACGAGTGG + Intergenic
1006315819 6:33290847-33290869 CCCTCCCCTCCCCCCACCATGGG - Exonic
1006458517 6:34145030-34145052 CCGTGCCCTCCGGCCTCCTGGGG - Intronic
1006535549 6:34696388-34696410 CCTTCCCCTCGGGGCCCCCGAGG + Intronic
1007552205 6:42738700-42738722 CCTTCCACTCCAGCCTCCAAAGG - Intergenic
1007761415 6:44135627-44135649 CCCTCCCCTCCAGCCAACAAGGG - Intronic
1007781385 6:44256918-44256940 TCATCCCCTCCGCCCTCCAGAGG + Intronic
1013637496 6:112043185-112043207 CCTTCCCTCCGGGCCAGCAGAGG - Intergenic
1014110955 6:117617853-117617875 TCTCCCACTCCTGCCACCAGCGG - Intergenic
1016586250 6:145689969-145689991 CCTTCCCACCCGACCATCAGTGG + Intronic
1016739090 6:147509194-147509216 CCGTCCCCACCGGCCGCCGGGGG + Exonic
1016871866 6:148825785-148825807 CCTTCTCCTCCCCCCACCATGGG - Intronic
1017751284 6:157492385-157492407 CCTTCCCCTTCAGCCACCACCGG + Intronic
1018420289 6:163634981-163635003 CCTTCTCCTCCACCCACCACAGG - Intergenic
1019242368 6:170679938-170679960 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
1019879587 7:3846801-3846823 CCTTCTCCTCCCGCTACGAGGGG + Intronic
1020308781 7:6854436-6854458 CCCTCTCCTCTGGCCACAAGAGG + Intergenic
1021577482 7:22117354-22117376 CCTTTCCCTCCGTCCACTTGTGG - Intergenic
1022207812 7:28180367-28180389 CCCTCCCCGCCGGCCACCCCTGG + Intronic
1022218594 7:28290041-28290063 CCCTCCCCTCCCCCCACCATTGG - Intergenic
1023418244 7:39951186-39951208 CCTCCTCCTCCGGCACCCAGCGG + Exonic
1024238774 7:47417452-47417474 CCTTCCCCTCTGACCACTACTGG - Intronic
1027147003 7:75702652-75702674 CCTTCCCCTTCAGCCATGAGCGG - Intronic
1029664099 7:101983366-101983388 CCCTCCCATCCTCCCACCAGTGG + Intronic
1031011196 7:116526256-116526278 CCTCCCCCGCCCGCCGCCAGGGG - Intronic
1033428978 7:141271308-141271330 CCTTCCCCTCAGGAAACCACAGG - Intronic
1033686526 7:143645945-143645967 CCTTACCCTCAGGCCAGCAGAGG + Intronic
1033689211 7:143721362-143721384 CCTTACCCTCAGGCCAGCAGAGG - Exonic
1033698086 7:143811670-143811692 CCTTACCCTCAGGCCAGCAGAGG - Intergenic
1034037559 7:147840401-147840423 CCTTCCTCTGCCCCCACCAGTGG - Intronic
1034256826 7:149729293-149729315 GCGTCCCCGCCTGCCACCAGCGG + Exonic
1035505749 8:128216-128238 CCTTCCCCTTCTGCCATGAGTGG + Intergenic
1035721790 8:1798215-1798237 CCTTCCGCTCCGCACCCCAGGGG - Intergenic
1035721917 8:1798733-1798755 CCTTCCGCTCCGCACCCCAGGGG - Intergenic
1035721926 8:1798770-1798792 CCTTCCGCTCCGCACCCCAGGGG - Intergenic
1035896467 8:3407970-3407992 CCTTCCCAGCTGGCCAGCAGTGG - Exonic
1036967930 8:13320950-13320972 CCCTTCCCTTCTGCCACCAGTGG + Intronic
1038332185 8:26617651-26617673 CCTTCCCCTCCTGCCTCAAGCGG - Intronic
1039377058 8:37045159-37045181 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
1040391896 8:46957130-46957152 ATTTCCCCTGCAGCCACCAGAGG - Intergenic
1045367903 8:101493482-101493504 CCTTTCCCCCCGGGCACCTGAGG - Intronic
1047169804 8:122481201-122481223 CCATCCCCGCCTGCCACCACTGG + Intergenic
1047169897 8:122482563-122482585 CCATCCCCACCTGCCACCACTGG + Intergenic
1048355208 8:133648052-133648074 CCTTCCCCTTCCACCATCAGTGG + Intergenic
1056138185 9:83649299-83649321 TCTCCCACCCCGGCCACCAGAGG - Intergenic
1056271755 9:84954256-84954278 GCGCCCCCTCAGGCCACCAGGGG + Intronic
1057906011 9:98984074-98984096 CCTTGCCCTCTGGCCTCCAGAGG + Intronic
1057971961 9:99567173-99567195 CCTTCCCCTTCTGCCAGGAGTGG + Intergenic
1060146939 9:121261140-121261162 CTGTCCCCGCAGGCCACCAGTGG - Intronic
1060884845 9:127143926-127143948 CCTCCCCTTCCGGGCACCTGGGG + Intronic
1061045070 9:128160438-128160460 CCTTCCGCTCCCGCCTCCACCGG - Exonic
1061682527 9:132250098-132250120 CTTTCCCCTCCTGCCCACAGAGG + Intergenic
1061968587 9:134030816-134030838 CCTGCCCCCTCGGCCTCCAGGGG + Exonic
1062206991 9:135342807-135342829 CCATCTCCCCAGGCCACCAGAGG - Intergenic
1062596632 9:137302578-137302600 CTTCTCCCTCCGGCCACCCGGGG + Intergenic
1203602559 Un_KI270748v1:29162-29184 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
1185527996 X:794401-794423 CCCTCCCCTACAGCCTCCAGAGG + Intergenic
1185536844 X:869232-869254 CCCTCCCCTACAGCCTCCAGAGG - Intergenic
1187642934 X:21314512-21314534 ACTTCCTCTACTGCCACCAGTGG - Intergenic
1190244017 X:48678522-48678544 CCTTCCCCTCCAACCCCTAGGGG - Intronic
1192362985 X:70450825-70450847 TCTTCCCCTCCAGAAACCAGGGG - Intronic
1197448448 X:126581034-126581056 CCTTCCCCACGCCCCACCAGCGG + Intergenic
1199413112 X:147548385-147548407 CCTCCCCCTCCCCCCACCGGGGG - Intergenic
1200066534 X:153506746-153506768 CAGTCCCCTCCCGCCACCTGGGG + Intronic
1200090135 X:153632048-153632070 CCTTTCCCTCCAGCCTTCAGAGG - Intergenic
1202384645 Y:24314260-24314282 CCTTCCCCTTCTGCCATGAGTGG - Intergenic
1202486139 Y:25355862-25355884 CCTTCCCCTTCTGCCATGAGTGG + Intergenic