ID: 985645240

View in Genome Browser
Species Human (GRCh38)
Location 5:1081839-1081861
Sequence AAGCTGTGACCCTTCCCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985645240_985645244 21 Left 985645240 5:1081839-1081861 CCGGAGGGGAAGGGTCACAGCTT 0: 1
1: 0
2: 2
3: 20
4: 190
Right 985645244 5:1081883-1081905 ATTCAAACACGCTTTCGAGATGG 0: 1
1: 0
2: 0
3: 4
4: 60
985645240_985645245 30 Left 985645240 5:1081839-1081861 CCGGAGGGGAAGGGTCACAGCTT 0: 1
1: 0
2: 2
3: 20
4: 190
Right 985645245 5:1081892-1081914 CGCTTTCGAGATGGTACCTCTGG 0: 1
1: 0
2: 1
3: 0
4: 29
985645240_985645241 -7 Left 985645240 5:1081839-1081861 CCGGAGGGGAAGGGTCACAGCTT 0: 1
1: 0
2: 2
3: 20
4: 190
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985645240 Original CRISPR AAGCTGTGACCCTTCCCCTC CGG (reversed) Intronic
900641719 1:3690813-3690835 CGACCGTGACCCTTCCCCTCGGG + Intronic
901842147 1:11960536-11960558 AGGCTGTGCCCCTTCATCTCTGG - Intronic
902977386 1:20098740-20098762 CAGCTGTGACCCCTGCCCTCTGG - Intergenic
905291132 1:36922497-36922519 TGGCTGCCACCCTTCCCCTCAGG + Intronic
906768204 1:48456074-48456096 AAGCCATAACCCTTCACCTCTGG + Intronic
907564855 1:55425288-55425310 AAGATGTGGCTCTTGCCCTCTGG + Intergenic
907748814 1:57242398-57242420 CCCCCGTGACCCTTCCCCTCTGG - Intronic
911702676 1:100972407-100972429 AAGCTGATATCCTTCCCCTGAGG - Intronic
914333619 1:146696141-146696163 AAGACGTGACCCTTGTCCTCAGG + Intergenic
914913838 1:151806206-151806228 CAGCTGTGAACCCTCCCCTGAGG - Intronic
915013648 1:152713233-152713255 AATCTGGGTCCCTTCCCTTCTGG - Intergenic
916810030 1:168297272-168297294 CAGGTGTGATCCTGCCCCTCTGG - Intronic
920368951 1:205465232-205465254 AGACAGTGACCCTTCCCCTGGGG + Intergenic
920951564 1:210575911-210575933 TAACTGTCACCCTTCCCCTCAGG - Intronic
924033734 1:239913935-239913957 AAGTTCTGACCCTACCACTCTGG + Exonic
1062976948 10:1690969-1690991 ACGCTGTGCCCCTTTCCTTCTGG + Intronic
1063269981 10:4497428-4497450 AAGCTGGGCCCCATCCCCACTGG + Intergenic
1063402935 10:5765177-5765199 CAGCTGTGACCCTTGCAATCAGG + Intergenic
1066434838 10:35387899-35387921 TAGGTATGGCCCTTCCCCTCTGG + Intronic
1068582284 10:58755317-58755339 AAGCTGTAGCCTTTCCCCTAAGG - Intronic
1068793508 10:61052639-61052661 ATGCTGTATCCCTTCCCTTCAGG + Intergenic
1072289604 10:93952039-93952061 AATTTGTGATCCTGCCCCTCAGG + Intronic
1072715515 10:97749889-97749911 AAGCTGCCACCCATCCCCTGGGG + Intronic
1073486829 10:103824437-103824459 ATGCTGTGTGGCTTCCCCTCCGG - Intronic
1074766102 10:116701043-116701065 AAGCTGTGGAACTTCCTCTCGGG + Exonic
1075223896 10:120608255-120608277 AAACCGTGACCCCTCCCTTCAGG + Intergenic
1077144860 11:1040295-1040317 AAGCCGTGACGCGCCCCCTCGGG - Intergenic
1077287306 11:1773241-1773263 AAGCTGGGTCCCTTCCCAGCAGG - Intergenic
1077998637 11:7475327-7475349 AACCTGTGATCCCTCCCCTAGGG + Intergenic
1079233998 11:18674510-18674532 AAGAGCTGACTCTTCCCCTCTGG + Intergenic
1079644091 11:22842266-22842288 AATCTGTGACACTGTCCCTCCGG - Intergenic
1084431140 11:69112074-69112096 AATCTGTGTCCCTTCAGCTCTGG + Intergenic
1084466801 11:69328069-69328091 AAGCTGTGCCCATTCCCATGGGG + Intronic
1085022773 11:73219520-73219542 AAGCTGTGAGCCTGCCCATGGGG - Intronic
1085308000 11:75499254-75499276 AAGCACTGACCCCTCCCCTCAGG + Intronic
1087052150 11:93896970-93896992 AAGCAGGGCCCCTTCCCATCAGG - Intergenic
1088326375 11:108605245-108605267 AAGCAGTGACCCTTCTGCTGGGG + Intergenic
1090692255 11:129196076-129196098 TAGCTATTTCCCTTCCCCTCAGG - Intronic
1091145070 11:133272556-133272578 AAGCCATGCTCCTTCCCCTCTGG + Intronic
1092928259 12:13291602-13291624 AAGCTGCGGTCCTTGCCCTCGGG - Intergenic
1095841641 12:46700489-46700511 AAGCTGTGACACTTTCCTTCTGG - Intergenic
1097863653 12:64542496-64542518 CAGCTGTACCCCTTCCCTTCTGG - Intergenic
1099444862 12:82740716-82740738 TATCTGTGACCCTCCCTCTCAGG + Intronic
1100077945 12:90810313-90810335 AAGCTGTGACCCTACCACCTTGG + Intergenic
1104307185 12:127620186-127620208 AAGCTGTGACCCATCCAGTTTGG + Intergenic
1104825225 12:131702832-131702854 TAGCTGTGATTCTACCCCTCGGG - Intergenic
1105225072 13:18424554-18424576 TACCTCTGACCCTTCCCCTCGGG + Intergenic
1105639976 13:22252435-22252457 AAGCAGTGGCCCTGCCCCTCTGG + Intergenic
1110166710 13:72451054-72451076 AAGCTGTGAAACAGCCCCTCAGG + Intergenic
1113692062 13:112318131-112318153 AAACTATGAACCATCCCCTCAGG + Intergenic
1118768571 14:68926729-68926751 AAGCTGTGACCTTTCCCATGAGG - Intronic
1122685332 14:103501922-103501944 AAGCTGTAGCCCCTCACCTCTGG + Intronic
1124474010 15:30015506-30015528 AAGCTGCAAGCCTTCCCCTTGGG - Intergenic
1124661648 15:31554863-31554885 AAGGTGTTTCCCTTCCTCTCAGG + Intronic
1125531005 15:40413322-40413344 TAGGTCTGACCCTTCTCCTCCGG - Intronic
1125725702 15:41867126-41867148 CAGCTGTGCCCCTGCCCCACAGG - Exonic
1128113265 15:65089566-65089588 CAGCCCTGACCCTTCCACTCTGG - Intergenic
1131198430 15:90375883-90375905 AGGCTGTGACCTTTTTCCTCAGG - Intergenic
1131511519 15:93051824-93051846 AAGCTGAGACCCACCCCCTTGGG + Intronic
1132110657 15:99099923-99099945 ATGCTGTGGCCCTTCCGCTCAGG + Intronic
1133294625 16:4745327-4745349 ATCATGTGACCCTGCCCCTCTGG + Intronic
1134242411 16:12515721-12515743 CAGATGTGACCCCTGCCCTCCGG - Intronic
1134380461 16:13719657-13719679 GTGCTGTGTCCCTTCCACTCAGG - Intergenic
1134828574 16:17304949-17304971 AAGCTGTCACCCTTTCTTTCTGG - Intronic
1137599783 16:49748808-49748830 TAGCAGTGACCTTCCCCCTCGGG - Intronic
1139434302 16:66927166-66927188 TAGCTGTGGCCCTTCCCAGCAGG + Intergenic
1139573418 16:67827142-67827164 AGGCTGTGGCCCTTCCCACCAGG - Intronic
1139999998 16:71015108-71015130 AAGACGTGACCCTTGTCCTCAGG - Intronic
1140271792 16:73472770-73472792 TAGCTGTGTCCCTTTCCCTGTGG + Intergenic
1141661603 16:85444558-85444580 AGGCCGTGACCTTTGCCCTCTGG - Intergenic
1141834337 16:86528700-86528722 GAGCTGTGACCGTGCACCTCAGG + Intergenic
1142105338 16:88299490-88299512 AAGCTGTGCTCCTTCCTGTCTGG - Intergenic
1143375155 17:6462943-6462965 AGGCTGTGGTCCTTCCTCTCTGG - Intronic
1145296853 17:21599245-21599267 ATCCAGTGACCCTTCCTCTCTGG - Intergenic
1147565938 17:41536493-41536515 AAGCTGTGGCCCATTCCATCTGG + Intergenic
1147778866 17:42925045-42925067 AAGCTGTGGCCCATCCCTGCAGG + Intergenic
1148053823 17:44781878-44781900 ATGCTGTGACTTGTCCCCTCTGG + Intergenic
1148123479 17:45225280-45225302 CAGCTGGGGCCCTTCCCTTCTGG + Intronic
1149654849 17:58304830-58304852 TAGCTGTGACCCTGACCCTCAGG - Intronic
1151531036 17:74704852-74704874 AAGCTGTGGCCCTGCCCTTGGGG - Intronic
1152514601 17:80815995-80816017 AAGCTGTGTCCACGCCCCTCGGG - Intronic
1152694200 17:81735489-81735511 AAGCAGTGAGCCTTCCCAGCAGG - Intergenic
1154197944 18:12279777-12279799 CTGCTGGGACCCTTCCCCTAAGG - Intergenic
1154528295 18:15314968-15314990 TGCCTCTGACCCTTCCCCTCGGG - Intergenic
1157904757 18:51559658-51559680 AAGCTGCTTCCCTTCCCCTGTGG - Intergenic
1159948092 18:74458216-74458238 CAGCTGTGACAGTTCCCCTGGGG - Intergenic
1159988530 18:74874524-74874546 CAGCTGTGACTCTTCCTCGCCGG - Intronic
1160244826 18:77148941-77148963 AAGCTGTGGACCATCTCCTCGGG - Intergenic
1160441438 18:78895870-78895892 AAGCTCTGACCCAACCCCACAGG + Intergenic
1160662524 19:307697-307719 AAGCTGAGACCCTTAACCTGGGG - Intronic
1160835821 19:1124052-1124074 CAGCTGTGACCTGTCCCGTCTGG - Intronic
1160866896 19:1260172-1260194 AACCTGTGCCCCTTCCCCTGGGG - Intronic
1160966547 19:1749310-1749332 GAGCCCGGACCCTTCCCCTCGGG + Intergenic
1161505606 19:4641755-4641777 AGGCTTCGATCCTTCCCCTCTGG + Intronic
1162139555 19:8577552-8577574 AAGTTCTGACCCCTCCCTTCAGG - Exonic
1162496942 19:11028646-11028668 AGGCGGTGACCTTTCCCATCAGG - Intronic
1162565085 19:11441538-11441560 AAGCTGACAGCCTCCCCCTCGGG - Intronic
1162958871 19:14114566-14114588 TAGCTCTGCCCCTTCCCCTGTGG + Intronic
1163724082 19:18912763-18912785 AAGCTGTGACCCAGGCCCCCTGG + Intronic
1166289631 19:41854121-41854143 AAGCTCTGGCCCTTTCCCTCAGG - Intergenic
1166323025 19:42031005-42031027 AAGATGTGAACCTTGCCTTCTGG + Intronic
1166948448 19:46411547-46411569 CAGCTGGGGCCCTTTCCCTCTGG + Exonic
1166976340 19:46607221-46607243 AAGCTGTGGCCCTGAGCCTCTGG - Intronic
925031124 2:650415-650437 AAGTTCTGAGCCTTCCCCTCAGG - Intergenic
928047295 2:27948997-27949019 AATCTGTCTCCCTTCCCCACAGG - Intronic
928743245 2:34380790-34380812 AAGCTGTGTCCATTCTCCCCTGG + Intergenic
932340912 2:70962151-70962173 GAGCTGTGGCTCTTCCCCTTGGG - Intronic
932654720 2:73600656-73600678 CACCTATGATCCTTCCCCTCAGG + Exonic
932662879 2:73672287-73672309 CACCTGTGATCCTTCCCCTCAGG + Intergenic
934115378 2:88785945-88785967 AAGCTGGGACACTTCCACTGAGG + Intergenic
934628208 2:95883000-95883022 AAGCTGCGACACTTCCACTGAGG - Intronic
934832162 2:97538866-97538888 AAGCTGCGACACTTCCACTGAGG - Intronic
935738335 2:106124668-106124690 AAGATGTCACTGTTCCCCTCTGG + Intronic
937002010 2:118476489-118476511 ATGATGTCACCCTTGCCCTCAGG + Intergenic
938527399 2:132146431-132146453 TGCCTCTGACCCTTCCCCTCGGG - Intergenic
939700694 2:145387064-145387086 ACACTGTAACCCTTGCCCTCTGG + Intergenic
946378924 2:219331625-219331647 AAGCTCTTTCCCTTCTCCTCAGG - Intronic
947528122 2:230891775-230891797 AAGCTCTGAGCCTTCACCCCAGG - Intergenic
947626323 2:231621395-231621417 TAGCTGTCACCCCTCCCCTGGGG - Intergenic
947637264 2:231686391-231686413 CTTCTGTGACCCTTCCCCGCTGG + Intergenic
948760905 2:240190522-240190544 AAGCTGTGCCCCATCACCTTGGG + Intergenic
948829919 2:240593717-240593739 CAGCTGTGACCCATCAGCTCAGG - Intronic
1168965013 20:1893958-1893980 AGGCCCCGACCCTTCCCCTCTGG + Intergenic
1169073556 20:2748703-2748725 AGGCTGTGACCCTGCCACCCTGG + Intronic
1169112076 20:3040725-3040747 AGGCTGTTACTCTTCCCCTATGG - Intergenic
1171173271 20:23034125-23034147 AAGCTGAGACCCCACCCCCCAGG + Intergenic
1173650717 20:44662418-44662440 AACCTGTGCCCCTCCCCCACTGG - Intergenic
1174132359 20:48354946-48354968 AAGCTGTGAGCCTCCCAGTCTGG + Intergenic
1176769124 21:13053572-13053594 TACCTCTGACCCTTCCCCTCGGG + Intergenic
1178396487 21:32247919-32247941 AGGCTGGGAGCCTGCCCCTCTGG + Intergenic
1178517775 21:33263367-33263389 TGGCTGTGTCCCTTCCCCGCTGG - Exonic
1179516099 21:41908030-41908052 GAGCAGTGACCTTTCCACTCCGG - Intronic
1180516234 22:16147641-16147663 TGCCTCTGACCCTTCCCCTCGGG + Intergenic
1180866643 22:19123299-19123321 AAGCTGTGGCCCTACCCCCTTGG - Intergenic
1181516731 22:23418416-23418438 AAGATGTGTTCCTTGCCCTCTGG - Intergenic
1184281482 22:43440031-43440053 AAGCCTTGACCCTCCCCTTCAGG - Intronic
1184281716 22:43441175-43441197 AACCTCTGACCCATCCCCTTAGG + Intronic
1184786127 22:46672821-46672843 AGGCTGTGTCCCCTGCCCTCAGG + Exonic
1185052141 22:48559536-48559558 AAGGTGGGCCCCTTCCCCCCTGG + Intronic
1185337674 22:50278056-50278078 ACGCTGAGACCCTCCCCCCCAGG - Intronic
952856256 3:37772969-37772991 GAGCTGTGACTCTGCCCCTTGGG + Intronic
953875391 3:46663755-46663777 TAACTGTGGCCCTTCCCCTGTGG - Intergenic
954984023 3:54773578-54773600 ATGCTGTGACACTTCACTTCTGG + Intronic
955022013 3:55130812-55130834 AAGTCGTGACCCTTCTCCCCAGG + Intergenic
958090097 3:88866373-88866395 AAGATGTGCCTCTTCCCCTTTGG + Intergenic
958528670 3:95294927-95294949 AAGCTGAGACCCTGGCCCACTGG + Intergenic
959903431 3:111684855-111684877 ATGCTGTCACCCTCCTCCTCAGG - Intronic
967204092 3:187103554-187103576 AAGCTCTGCCCCCTCCCCTATGG - Intergenic
967294881 3:187955094-187955116 GTGGTGTGACCCTTCCTCTCTGG - Intergenic
968614852 4:1572799-1572821 AAGCTGAGGCCCGGCCCCTCTGG - Intergenic
968768802 4:2489988-2490010 AAGCTCTGTCCCTTCCCTTCTGG + Intronic
969584696 4:8084981-8085003 AAGCTCTGCCCCTTCCCGTGAGG - Intronic
972258482 4:37384200-37384222 AAGATGTCAGCCTTTCCCTCAGG + Intronic
976220528 4:82753537-82753559 AACCTGAAACCCTTCCCCGCAGG - Intronic
979748675 4:124248492-124248514 AAGCTGTGGCCCTTCTCATCAGG - Intergenic
984169800 4:176345817-176345839 AAGCTGTGAGCCTTCTGCTCGGG + Intergenic
985645240 5:1081839-1081861 AAGCTGTGACCCTTCCCCTCCGG - Intronic
986992685 5:13572126-13572148 CAGCTTCTACCCTTCCCCTCTGG + Intergenic
990161254 5:52943154-52943176 AAGCTGGAACCATTCCCCTGGGG - Intronic
992024990 5:72661461-72661483 AGGCTGTGGCCCTTGTCCTCAGG + Intergenic
997474772 5:134136476-134136498 CAGCCTTCACCCTTCCCCTCAGG - Intronic
1000006786 5:157192784-157192806 ACTCTGTGACCCTTCCCCCTGGG + Intronic
1000882344 5:166712942-166712964 AGTCTGTGACCCTTCCCAGCTGG + Intergenic
1001579721 5:172790308-172790330 CACCTCTGACCCTTCCCCTCTGG - Intergenic
1001655082 5:173343185-173343207 AAGCTGCAACCCTTGCCCTTTGG + Intergenic
1001680303 5:173552080-173552102 AAGAAGTGAGCCTTCCCTTCTGG - Intergenic
1002066346 5:176653876-176653898 AAGCTGGGACCTGTCCTCTCAGG + Intronic
1004208397 6:13614175-13614197 AAGACCTGGCCCTTCCCCTCAGG + Exonic
1004643676 6:17539482-17539504 AAGCTGCCTCCCTTTCCCTCTGG + Intronic
1005267342 6:24126123-24126145 AAGCTGGAACCCTGCCCCTTTGG + Intronic
1006836112 6:36999755-36999777 AAGTTGTGACACTTCCTCCCTGG + Intergenic
1008556860 6:52681019-52681041 ATGCTTTGACCCTACCCCCCAGG + Intronic
1013195811 6:107844655-107844677 AAGCTGTACCCCTTCCCCACTGG - Intergenic
1015607063 6:134968651-134968673 TAGGTGTGACACTTCCCCTTTGG - Intronic
1015812577 6:137175629-137175651 AATCTCAGCCCCTTCCCCTCAGG - Intergenic
1019640533 7:2101234-2101256 TGGCTGTGGCCCTTCCCCCCAGG - Intronic
1022087831 7:27086431-27086453 AAGCTGTTACCCTTCCTATAGGG + Intergenic
1022568914 7:31431930-31431952 AAGCTGTGTCCCTACCACTTTGG - Intergenic
1024055952 7:45659952-45659974 TGTCTGTGCCCCTTCCCCTCTGG + Intronic
1024178493 7:46864156-46864178 AGGGGGTGACCCTTGCCCTCTGG + Intergenic
1024549912 7:50554101-50554123 AAGCAGTGACTCTTGACCTCAGG - Intronic
1024821390 7:53334756-53334778 GAGCTGGGACCCTTCCCCTCAGG - Intergenic
1024822120 7:53343995-53344017 AAACTGTGATCCTTCCCCTCAGG + Intergenic
1026877667 7:73888815-73888837 AAGCTGTAACCCATCCACTTTGG + Intergenic
1026968809 7:74455504-74455526 ATGCTGGTGCCCTTCCCCTCTGG - Intronic
1027340423 7:77201830-77201852 AAGCTGTGACACTTCCCTGTTGG + Intronic
1027733431 7:81903839-81903861 AAGCTGTGCCCCTACCACACAGG - Intergenic
1029713137 7:102310631-102310653 AAGCAGCGGCCCTTCCCCCCGGG - Intronic
1029944966 7:104522756-104522778 ATGCTGTGAGCCTTCCCCAGTGG - Intronic
1032699326 7:134364878-134364900 AATCTCTGACCCTTCACCTTGGG - Intergenic
1038715399 8:29986637-29986659 AAGTCATGACCCTTCCCCTCTGG + Intergenic
1039507075 8:38059898-38059920 AAACTGTGACTCTTCACCTGGGG - Exonic
1041639439 8:60180667-60180689 AAGCTGTGGCACATCTCCTCCGG - Intergenic
1042427951 8:68670839-68670861 AAGCTTTCACCCTGCCCCTAAGG + Intronic
1045332376 8:101166480-101166502 AGGCTTTGGCCCTTCCTCTCAGG - Intergenic
1048006324 8:130422191-130422213 AAGATGTGCCCATCCCCCTCAGG - Intronic
1049062521 8:140287015-140287037 CTGCTGTGACCCTGCCTCTCTGG - Intronic
1049476303 8:142798449-142798471 AAGCTGTGACCCTGACCCAAGGG + Intergenic
1053351195 9:37414459-37414481 GAGCTGTTACCCTGCCCCCCAGG + Intergenic
1056957174 9:91091745-91091767 AAGTTGGTACCATTCCCCTCTGG - Intergenic
1057357067 9:94340662-94340684 CACCTGTGCCCCTTCCCTTCTGG - Intergenic
1057650685 9:96916965-96916987 CACCTGTGCCCCTTCCCTTCTGG + Intronic
1059435903 9:114276069-114276091 AAGCTGTGGCCCTTACCCCTGGG + Intronic
1062459251 9:136656020-136656042 ACGCAGTTCCCCTTCCCCTCTGG + Intergenic
1186457094 X:9718232-9718254 AAGCCCTGACCCTTCCCCGATGG - Exonic
1188729640 X:33630957-33630979 ATGCTGTGGCCCTGCTCCTCGGG - Intergenic
1199415579 X:147578936-147578958 AAGCTGGAACCATTCCCCTTGGG + Intergenic
1200088323 X:153622467-153622489 AGGCTGTGGCCCCTCCCCACAGG - Intergenic
1200800379 Y:7381578-7381600 AAGCTGTGACTTTTCTCCTTTGG + Intergenic
1202164025 Y:21968062-21968084 AAGCTGTGAGCCTTCCGCCTGGG - Intergenic
1202227331 Y:22618302-22618324 AAGCTGTGAGCCTTCCGCCTGGG + Intergenic
1202315791 Y:23577352-23577374 AAGCTGTGAGCCTTCCGCCTGGG - Intergenic
1202554974 Y:26092722-26092744 AAGCTGTGAGCCTTCCGCCTGGG + Intergenic