ID: 985645241

View in Genome Browser
Species Human (GRCh38)
Location 5:1081855-1081877
Sequence ACAGCTTGTGCGCCGCAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985645231_985645241 14 Left 985645231 5:1081818-1081840 CCCGGCAGGTGCCACTGGTGGCC 0: 1
1: 1
2: 2
3: 22
4: 247
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37
985645237_985645241 3 Left 985645237 5:1081829-1081851 CCACTGGTGGCCGGAGGGGAAGG 0: 1
1: 0
2: 3
3: 28
4: 310
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37
985645227_985645241 20 Left 985645227 5:1081812-1081834 CCACTCCCCGGCAGGTGCCACTG 0: 1
1: 0
2: 1
3: 27
4: 333
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37
985645240_985645241 -7 Left 985645240 5:1081839-1081861 CCGGAGGGGAAGGGTCACAGCTT 0: 1
1: 0
2: 2
3: 20
4: 190
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37
985645230_985645241 15 Left 985645230 5:1081817-1081839 CCCCGGCAGGTGCCACTGGTGGC 0: 1
1: 0
2: 1
3: 13
4: 200
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37
985645225_985645241 24 Left 985645225 5:1081808-1081830 CCGCCCACTCCCCGGCAGGTGCC 0: 1
1: 0
2: 8
3: 72
4: 845
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37
985645226_985645241 21 Left 985645226 5:1081811-1081833 CCCACTCCCCGGCAGGTGCCACT 0: 1
1: 0
2: 1
3: 20
4: 259
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37
985645232_985645241 13 Left 985645232 5:1081819-1081841 CCGGCAGGTGCCACTGGTGGCCG 0: 1
1: 0
2: 1
3: 12
4: 166
Right 985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985645241 Original CRISPR ACAGCTTGTGCGCCGCAAGC AGG Intronic
902825731 1:18972848-18972870 ACAGCTAGTCAGCAGCAAGCAGG + Intergenic
908834855 1:68218725-68218747 ACAGCTTGTGTGCAGGAACCTGG + Intronic
911693718 1:100863778-100863800 ACAGCTTGTGCTCCACACCCAGG - Intergenic
1062999759 10:1905686-1905708 ACAGCTTGTGCGCCCCAGGATGG + Intergenic
1076356880 10:129859723-129859745 CCAGCGTGTGCCCCGCCAGCTGG - Intronic
1078682221 11:13487503-13487525 GCAGCTGGTGGGCCGCAAGTTGG - Intergenic
1083622752 11:64057066-64057088 AGAGCTGGTGCGACGCAGGCTGG - Intronic
1092289433 12:7150444-7150466 ACAGCTTGTGTGGCGTCAGCTGG + Intronic
1102031933 12:109744603-109744625 ACAGCTCATGGGCCTCAAGCGGG - Intronic
1118253864 14:64187944-64187966 ACAGCTGGTCTGCAGCAAGCAGG - Intronic
1121404782 14:93713036-93713058 CCAGCTTCTGCACTGCAAGCTGG - Intergenic
1133359961 16:5166391-5166413 ACAGCTGGTGGGTCTCAAGCTGG - Intergenic
1133412488 16:5580107-5580129 ACAGCTTGTAAGCCCCAAGAGGG + Intergenic
1144747377 17:17624981-17625003 GCAGCTGGTTCGCCGCAAGACGG + Intergenic
1147438622 17:40433187-40433209 ACAGTTTGTGCATCCCAAGCTGG + Intergenic
1156468033 18:37360377-37360399 ACAGGTTGTGCTCAGCAGGCTGG - Intronic
1160691827 19:463861-463883 GCAGCCTGTGCCCCGCAGGCCGG + Exonic
1160856886 19:1221746-1221768 ACAGCCTGTGCGCGGCTGGCAGG - Intronic
1167660336 19:50792389-50792411 ACAGCTAGTGAGTAGCAAGCTGG - Intronic
927509462 2:23635389-23635411 ACAGCTGGTTCCCCCCAAGCTGG + Intronic
935626430 2:105175725-105175747 ACAGCTGGAGAGCCGGAAGCTGG - Intergenic
945119373 2:206442921-206442943 AGAGCGTTTGCGCCGCAGGCTGG - Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
985297888 4:188455185-188455207 ACACCTTGGGTGCCTCAAGCTGG + Intergenic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
993873082 5:93274405-93274427 ACAGCTTGTGCCCCTGAATCAGG + Intergenic
994187369 5:96830207-96830229 CCAGCTTGTGGTCCCCAAGCTGG + Intronic
1004075964 6:12344425-12344447 ACAGCTTGAGTGAGGCAAGCAGG + Intergenic
1006906211 6:37535562-37535584 ACAGCTTTTGCGCTTCCAGCTGG + Intergenic
1016317331 6:142805278-142805300 ACAGCTTGTGCTCCCCATGGAGG + Intronic
1018230401 6:161669895-161669917 AGAGCCTGTGCGCTGCAGGCTGG - Intronic
1019503265 7:1376243-1376265 ACAGCTGATGGGCCGTAAGCTGG + Intergenic
1023862377 7:44224403-44224425 ACAGCTTGTCCTCAGCCAGCAGG - Intronic
1032967878 7:137122244-137122266 CCAGCTTTTTCCCCGCAAGCAGG - Intergenic
1035226048 7:157432739-157432761 GCAGCTTGTGTGCCGGAAGCTGG + Intergenic
1053668538 9:40336389-40336411 ACAGCTTGTGGGCTGAATGCAGG - Intergenic
1053918344 9:42962678-42962700 ACAGCTTGTGGGCTGAATGCAGG - Intergenic
1054379677 9:64476442-64476464 ACAGCTTGTGGGCTGAATGCAGG - Intergenic
1054516073 9:66039905-66039927 ACAGCTTGTGGGCTGAATGCAGG + Intergenic
1060480447 9:124014035-124014057 ACTGCTTGTCCACCGCCAGCAGG - Exonic
1060928700 9:127474123-127474145 ACAGCTTGTGCTTGGCAAGCTGG - Intronic