ID: 985645705

View in Genome Browser
Species Human (GRCh38)
Location 5:1083803-1083825
Sequence GATGAAGTACTCGTCACAGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 49}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985645699_985645705 12 Left 985645699 5:1083768-1083790 CCCGGGATGCCCTGGATTTCGGT 0: 1
1: 0
2: 3
3: 9
4: 83
Right 985645705 5:1083803-1083825 GATGAAGTACTCGTCACAGGCGG 0: 1
1: 0
2: 1
3: 4
4: 49
985645701_985645705 3 Left 985645701 5:1083777-1083799 CCCTGGATTTCGGTGACGTTGTT 0: 1
1: 0
2: 0
3: 5
4: 48
Right 985645705 5:1083803-1083825 GATGAAGTACTCGTCACAGGCGG 0: 1
1: 0
2: 1
3: 4
4: 49
985645695_985645705 24 Left 985645695 5:1083756-1083778 CCACTGGCCGCGCCCGGGATGCC 0: 1
1: 0
2: 1
3: 15
4: 132
Right 985645705 5:1083803-1083825 GATGAAGTACTCGTCACAGGCGG 0: 1
1: 0
2: 1
3: 4
4: 49
985645702_985645705 2 Left 985645702 5:1083778-1083800 CCTGGATTTCGGTGACGTTGTTC 0: 1
1: 0
2: 1
3: 2
4: 36
Right 985645705 5:1083803-1083825 GATGAAGTACTCGTCACAGGCGG 0: 1
1: 0
2: 1
3: 4
4: 49
985645697_985645705 17 Left 985645697 5:1083763-1083785 CCGCGCCCGGGATGCCCTGGATT 0: 1
1: 0
2: 1
3: 3
4: 120
Right 985645705 5:1083803-1083825 GATGAAGTACTCGTCACAGGCGG 0: 1
1: 0
2: 1
3: 4
4: 49
985645700_985645705 11 Left 985645700 5:1083769-1083791 CCGGGATGCCCTGGATTTCGGTG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 985645705 5:1083803-1083825 GATGAAGTACTCGTCACAGGCGG 0: 1
1: 0
2: 1
3: 4
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985645705 Original CRISPR GATGAAGTACTCGTCACAGG CGG Exonic
903540007 1:24091511-24091533 GTTGAGGTAGTCGTCACATGTGG + Intronic
903853038 1:26319712-26319734 GAAGAAGTAGTGGTCACATGGGG + Intronic
909833371 1:80222480-80222502 GATGTACCACTCCTCACAGGTGG - Intergenic
915216781 1:154345801-154345823 GATGAAATACTGGTCATAGACGG - Exonic
922585605 1:226732954-226732976 GATGAAGAAAGCGCCACAGGAGG + Intronic
1073034175 10:100551696-100551718 TAACAAGTACTTGTCACAGGTGG - Exonic
1079148140 11:17873090-17873112 GATGAAGTACTCCTATCTGGTGG + Intronic
1086807251 11:91259916-91259938 GAAGAAGGACTGTTCACAGGGGG + Intergenic
1086807256 11:91259950-91259972 GAAGAAGGACTGTTCACAGGGGG + Intergenic
1093138753 12:15482065-15482087 ATTGCAGTACTCTTCACAGGAGG + Intronic
1104603441 12:130169379-130169401 GATGAGGTCATGGTCACAGGCGG + Intergenic
1118825791 14:69379793-69379815 GATGAAGTACTCTTTCTAGGAGG - Intergenic
1124582117 15:30966117-30966139 TATGAGGTACTTGTCAAAGGAGG + Intronic
1128836643 15:70814144-70814166 GCTGAAGTAATCTTCTCAGGAGG + Intergenic
1135186765 16:20322357-20322379 GATGAATTTCTCGTCCCAGGAGG - Intronic
1140340404 16:74153622-74153644 GATGAAGTCCTACTCATAGGTGG - Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1151718237 17:75842435-75842457 GATGAAGGTCTCGTCCCAGACGG + Exonic
1152029582 17:77833759-77833781 GCTGAGGTCCTCATCACAGGAGG + Intergenic
1157940715 18:51926151-51926173 GAGGAAATACTCTTCACAGATGG - Intergenic
1161503905 19:4633699-4633721 GATGAAGTCATCGTGACAGATGG + Intergenic
927079114 2:19610340-19610362 GAGGAAGCAGTGGTCACAGGTGG - Intergenic
941857993 2:170249964-170249986 GATGAAGAGCTTGTCATAGGAGG - Intronic
948502944 2:238408243-238408265 GGTGAGCTCCTCGTCACAGGAGG + Intergenic
1173824828 20:46041460-46041482 GGTGAAGTATTCATCACAGGTGG - Exonic
981004118 4:139857598-139857620 AATGAAGTCCTTGTCACTGGAGG - Intronic
984979625 4:185267086-185267108 GATGAAGTCCTCGTAAGAGGGGG - Exonic
985645705 5:1083803-1083825 GATGAAGTACTCGTCACAGGCGG + Exonic
993432813 5:87852683-87852705 GCTGATGAACTTGTCACAGGAGG + Intergenic
1002704687 5:181152481-181152503 GATGCAGCTCTCGTTACAGGTGG + Intergenic
1004249368 6:14010773-14010795 GATGAGGTGCTCATCACTGGAGG + Intergenic
1017820599 6:158046369-158046391 GATGAAGTCATCTTCACAGGGGG + Intronic
1017972116 6:159321775-159321797 GTTATAGTACTCGTCACAAGTGG + Intergenic
1020472435 7:8554323-8554345 GATGATGCACTTGTCAGAGGAGG + Intronic
1049927473 9:423455-423477 GATGAAGCACCCATCAAAGGGGG + Intronic
1052756082 9:32543167-32543189 GATGAAGAACTTGTCACAGGAGG - Exonic
1059874933 9:118623992-118624014 GATGAAGTAGTAGTCAGAGTGGG - Intergenic
1060121122 9:120990787-120990809 GCTGAAGTACTGGTCCCAGAAGG - Intronic
1186217648 X:7317138-7317160 GATGATGTTCTCATCACAGAAGG - Intronic
1187064794 X:15822983-15823005 GGAAAAGTAGTCGTCACAGGGGG + Exonic
1190105791 X:47560613-47560635 TATGAAAAACTAGTCACAGGTGG - Intergenic
1201551482 Y:15221355-15221377 GAAGAAGTACTCTTAACTGGAGG - Intergenic