ID: 985649653

View in Genome Browser
Species Human (GRCh38)
Location 5:1101458-1101480
Sequence CTATTGGGAGGGCTCCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985649653_985649660 1 Left 985649653 5:1101458-1101480 CCTTGGAGGAGCCCTCCCAATAG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 985649660 5:1101482-1101504 CAGCAAAGGCCGACAGCCGCTGG 0: 1
1: 0
2: 1
3: 3
4: 82
985649653_985649664 22 Left 985649653 5:1101458-1101480 CCTTGGAGGAGCCCTCCCAATAG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 985649664 5:1101503-1101525 GGTGGAGAACCAGCAACACCAGG No data
985649653_985649661 4 Left 985649653 5:1101458-1101480 CCTTGGAGGAGCCCTCCCAATAG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 985649661 5:1101485-1101507 CAAAGGCCGACAGCCGCTGGTGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985649653 Original CRISPR CTATTGGGAGGGCTCCTCCA AGG (reversed) Intronic
901678776 1:10901484-10901506 CAATTGGGAGGGCCCCACCCCGG - Intergenic
901941537 1:12666048-12666070 CTATGGGGTGGACCCCTCCAGGG + Exonic
902116241 1:14123967-14123989 CTATTGGGAAGGAGCCTCCGAGG - Intergenic
902752250 1:18525068-18525090 CTATTGTGATGCCTCCTGCATGG - Intergenic
902836168 1:19048039-19048061 CCATTGCTAGGGCTCCTCCCAGG - Intergenic
906225880 1:44120740-44120762 CTATTGGGTGGGCACCTCTGGGG - Intronic
910240959 1:85085650-85085672 CTCTTTGGAGGGCTGCTCTAGGG - Intronic
912933628 1:113984703-113984725 GTATTGAGAGGGCTCCCCCAAGG + Intergenic
914938316 1:152000081-152000103 GTACTGGGAGGACTCCACCAAGG + Intergenic
916010848 1:160704202-160704224 ATACTGCTAGGGCTCCTCCAGGG - Intronic
917028417 1:170665244-170665266 CAATAGGGAGAGCTCCTCTAAGG - Intronic
919748393 1:201022535-201022557 CTATTGGGAGGGGTACACAAAGG - Intronic
921161920 1:212478929-212478951 CTATGTGGAGGAGTCCTCCAGGG - Intergenic
921944044 1:220874417-220874439 GTACTAGGTGGGCTCCTCCAGGG + Intergenic
922567458 1:226610288-226610310 CTACTGCGATGGCCCCTCCAAGG + Intergenic
1063377927 10:5565238-5565260 CTCTTGGGTGGGCTTCTCCCAGG + Intergenic
1065187729 10:23185283-23185305 ATCTCTGGAGGGCTCCTCCAGGG + Intergenic
1068028334 10:51677019-51677041 TTATTGGGAGGGCACATACAGGG - Intronic
1072012554 10:91315707-91315729 CAACTGGGATGGCTGCTCCACGG + Intergenic
1077206906 11:1349167-1349189 CCACAGGCAGGGCTCCTCCAGGG - Intergenic
1078933942 11:15936060-15936082 CTATTGGGAAGCCCCCTTCATGG - Intergenic
1083660670 11:64250595-64250617 GTATTGGGGGGGCTCCCACAGGG + Intergenic
1085189545 11:74606986-74607008 CTATTGGGAGGGCAGGTCCAGGG - Intronic
1089184332 11:116604550-116604572 CACTTGGGAGGGTTCCTCTAAGG - Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1093228930 12:16519126-16519148 ATGTTGGAAGGGCTCGTCCATGG - Intronic
1093973591 12:25397236-25397258 CTTGTTGGAGGCCTCCTCCAAGG - Intergenic
1097224018 12:57466287-57466309 CCACTGGGGGGGCTGCTCCAGGG + Exonic
1098314150 12:69175936-69175958 CTCTTGGAAGGGCTGTTCCAAGG - Intergenic
1104252036 12:127104432-127104454 CTCTAGGGAGGGTTCCTCTAGGG + Intergenic
1113835533 13:113326185-113326207 CTCTTGGGAGGGGTCCTCCCAGG - Intronic
1114661054 14:24345082-24345104 CTTTTGGGGAGCCTCCTCCAGGG + Intergenic
1117278452 14:54213435-54213457 CTCTTGGGTGTGCTCCTTCAGGG - Intergenic
1123675499 15:22707299-22707321 CTGTTGGGAGGGCTCCTCTTTGG + Intergenic
1124327490 15:28780237-28780259 CTGTTGGGAGGGCTCCTCTTTGG + Intergenic
1124529501 15:30492240-30492262 CTGTTGGGAGGGCTCCTCTTTGG + Intergenic
1124769155 15:32515440-32515462 CTGTTGGGAGGGCTCCTCTTTGG - Intergenic
1129451299 15:75652695-75652717 CCATTGGGAGGGGTCCTCCCGGG - Intronic
1133518369 16:6532004-6532026 CCACTGTGAGGTCTCCTCCATGG + Intronic
1136116996 16:28100933-28100955 GTACTAGGAGGGCTCCTCCCAGG + Intronic
1137021124 16:35428473-35428495 CTGTTGGCAGGGCTCATGCAAGG + Intergenic
1137027762 16:35495465-35495487 CTGTTGGCAGGGCTCATGCAAGG + Intergenic
1145997693 17:29113931-29113953 AGATGGGGAGGGCTCCACCACGG + Intronic
1149183055 17:53963434-53963456 CTAATGAGAGGGCACCTCAAGGG + Intergenic
1149520919 17:57317823-57317845 CTCTTGGGAAGGGTGCTCCAGGG + Intronic
1151890750 17:76949277-76949299 CCATGGGGAGGGCCCCTCCTTGG - Exonic
1151893178 17:76963230-76963252 CTATGGGGAGGGCCCCACAATGG + Intergenic
1152109280 17:78348361-78348383 CTACTGTGAAGGCTCCCCCAGGG - Intergenic
1153904620 18:9650234-9650256 ATATTGCTAGGGCTCCTCCCAGG + Intergenic
1159561390 18:69998988-69999010 CTTTTGGGAAGGCTCCTTAAAGG + Intergenic
1160194004 18:76737956-76737978 CTACTGGGAGGCCCCCCCCAGGG - Intergenic
1160990628 19:1858961-1858983 GGATGGGGAGGGCTCCCCCAGGG - Intronic
925237166 2:2289979-2290001 CTATGGGGAGGTCTTCCCCAGGG - Intronic
925349938 2:3193998-3194020 CCAGTGGGAGTGCTCCTCCAGGG + Exonic
927083493 2:19652954-19652976 ATAATGGGAGGGCTCCAGCAGGG - Intergenic
928093491 2:28390688-28390710 CTACTGGGAGGGCTCAGGCAGGG + Intergenic
928270459 2:29850576-29850598 CTTTTGGGAGGCCTCATGCAAGG - Intronic
935546151 2:104401488-104401510 CTATTGGAAGTGCTGCTCTAGGG - Intergenic
946476424 2:220010735-220010757 CTGTTGTGTGGGCTTCTCCATGG + Intergenic
1169869620 20:10237027-10237049 CTTTTGGGAGGGCTCAACCTAGG - Intronic
1170505808 20:17024659-17024681 CTAATGGAAGAGCCCCTCCATGG - Intergenic
1174302176 20:49590253-49590275 CTATTGGGATGACAGCTCCAAGG - Intergenic
1177962218 21:27681263-27681285 CTGTTGGGAGAGATTCTCCAAGG - Intergenic
1179373737 21:40830350-40830372 CCATTAGGAGGGATCCTTCATGG - Intronic
1181983666 22:26784083-26784105 CCCTGGGGAGGGCTCCTACAAGG + Intergenic
1183014937 22:34978324-34978346 CTGTTGGCTGGGCTCCTCCCAGG - Intergenic
1184804058 22:46781116-46781138 AAATTGGGAGGGCACCTCCAGGG - Intronic
1185014341 22:48334479-48334501 CTCGGGGGAGGCCTCCTCCAAGG + Intergenic
1185398887 22:50605879-50605901 CTGGTGGCAGGGCACCTCCACGG - Exonic
949395652 3:3612207-3612229 CTTCTGGGAGGCCTCCTCCTAGG + Intergenic
949839052 3:8300583-8300605 CTATTGATAGGGCTTCTCTATGG - Intergenic
951816992 3:26765064-26765086 CTATGGAGATGGCACCTCCAAGG + Intergenic
952847751 3:37702444-37702466 GTATTGAGAGGTCTTCTCCAAGG + Intronic
953742023 3:45546217-45546239 CAGTTGGGAGGTCTCTTCCAGGG + Intronic
954428146 3:50454394-50454416 CTGTTGTGGGGGCCCCTCCAGGG - Intronic
967186666 3:186950038-186950060 CTAGATGGAGAGCTCCTCCAGGG - Intronic
967949438 3:194829501-194829523 GGATTGGGGGAGCTCCTCCAGGG + Intergenic
968002367 3:195214721-195214743 CTAAGGGGAGGGTTCCTGCAGGG - Intronic
968755046 4:2411212-2411234 CAAGTGGGGGGGCCCCTCCATGG - Intronic
969536889 4:7761832-7761854 CTGGAGGGAGGGCTCCTCTATGG + Exonic
985649653 5:1101458-1101480 CTATTGGGAGGGCTCCTCCAAGG - Intronic
985799993 5:1999230-1999252 CTATGGCCAGGTCTCCTCCATGG + Intergenic
986892193 5:12322104-12322126 ACATCTGGAGGGCTCCTCCATGG - Intergenic
988936803 5:36091621-36091643 CTATTGAGAGGGCAGCACCAAGG - Intergenic
992467023 5:77016130-77016152 CTCTTGTCTGGGCTCCTCCAGGG + Intergenic
1002555958 5:180040818-180040840 CTATAGGGAGAGATGCTCCATGG + Intronic
1006861470 6:37174245-37174267 CTGTTGGGAGGCAGCCTCCAGGG - Exonic
1008927042 6:56897890-56897912 CTTGTGGAAGGGCTCTTCCATGG + Intronic
1011684658 6:89814777-89814799 CCATTGGGAGATCTCCGCCAGGG + Intronic
1011844792 6:91550539-91550561 CTATTTGCAGGGTTCCTCCAAGG + Intergenic
1013012503 6:106133277-106133299 CTATTGGAAGGGCTGGTCTAGGG - Intergenic
1016581255 6:145631127-145631149 CTCTTGAGAGGGCTCCTCTAGGG - Intronic
1017993274 6:159508854-159508876 CTAAAGGGAGGGCTGCTCCGGGG - Intergenic
1019378349 7:708175-708197 GTATTGGGATGGCTCCTTCTGGG - Intronic
1019378365 7:708254-708276 GTATTGGGATGGCTCCTTCTGGG - Intronic
1021939881 7:25668919-25668941 CTATTTGGTGAGCTCCTCGAGGG + Intergenic
1022206849 7:28173065-28173087 ATACTGCTAGGGCTCCTCCAGGG + Intronic
1024470397 7:49764094-49764116 CCATGGGGATTGCTCCTCCATGG - Intergenic
1026611475 7:71863669-71863691 CTATTGGGAAGGCTCCACGCAGG + Intronic
1029180804 7:98700427-98700449 CTCTCTGGAGGGCTCCTCCTGGG + Intergenic
1034347011 7:150392466-150392488 TTATTGGCATGGCTCTTCCATGG - Intronic
1041076160 8:54171980-54172002 CTATTCTGACAGCTCCTCCATGG + Intergenic
1042852199 8:73227203-73227225 GTATTGGTAGGGCTCCTCTTAGG - Intergenic
1049015219 8:139915129-139915151 CTTTTGGGCGGGCTCCTGGAGGG + Intronic
1049719237 8:144107978-144108000 TTATGGGGAGCCCTCCTCCAGGG - Intronic
1058535001 9:105949960-105949982 CTACTGGGAGCTCTCTTCCAAGG + Intergenic
1058732260 9:107861755-107861777 CTGCTGGGACCGCTCCTCCAAGG + Intergenic
1060993456 9:127862125-127862147 CTAGTGCGTGGGCTCCTGCATGG - Intergenic
1062385336 9:136307125-136307147 CTGCTGGGAGGGCTTCTCCTGGG - Intergenic
1185835356 X:3341733-3341755 CTTTTTAGAGGGCTCCACCAAGG + Intronic
1186707662 X:12159150-12159172 CTCTTGTAAGGTCTCCTCCAAGG + Intronic
1188273103 X:28166839-28166861 CTAAAGCAAGGGCTCCTCCAGGG + Intergenic
1190339067 X:49282082-49282104 CTATTGGGCTGTCTACTCCAAGG - Intronic
1197939987 X:131779179-131779201 CAATTGACAGGGTTCCTCCAAGG + Intergenic
1198571882 X:137966076-137966098 CTATTGTGAGGGCAGCACCAAGG + Intergenic