ID: 985650218

View in Genome Browser
Species Human (GRCh38)
Location 5:1104092-1104114
Sequence GACCCAGGAGGGGCCTGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 1, 2: 11, 3: 69, 4: 621}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985650211_985650218 -4 Left 985650211 5:1104073-1104095 CCCTTGGCGGCATGGAGGGGACC 0: 1
1: 0
2: 0
3: 12
4: 106
Right 985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG 0: 1
1: 1
2: 11
3: 69
4: 621
985650204_985650218 17 Left 985650204 5:1104052-1104074 CCTCTGGGCTGCGGTCGGGGACC 0: 1
1: 0
2: 0
3: 18
4: 156
Right 985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG 0: 1
1: 1
2: 11
3: 69
4: 621
985650212_985650218 -5 Left 985650212 5:1104074-1104096 CCTTGGCGGCATGGAGGGGACCC 0: 1
1: 0
2: 1
3: 17
4: 184
Right 985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG 0: 1
1: 1
2: 11
3: 69
4: 621

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985650218 Original CRISPR GACCCAGGAGGGGCCTGGCC TGG Intronic
900151993 1:1182813-1182835 GCCCTAGGAGGGGCGTGGCTGGG + Intronic
900154732 1:1199334-1199356 GAAGCAGGAGGGGCCTGGGAGGG + Intergenic
900181845 1:1314584-1314606 GAGACAGAAGGAGCCTGGCCAGG + Intronic
900192128 1:1356207-1356229 GACCCCCGAGGGCCCTGGCAGGG + Intronic
900383849 1:2400188-2400210 GAACGAGGAGGGTCCTGGCAGGG - Intronic
900511235 1:3062101-3062123 GACCTAGGTGGGGCCTGCCCTGG - Intergenic
900591623 1:3462828-3462850 GACACAGGATGGGACTGGGCAGG - Intronic
900786308 1:4652889-4652911 GACCCAGGGGCGGCCCGGCAGGG + Intergenic
901027846 1:6288395-6288417 GACCCCGTAGGTGCTTGGCCGGG + Intronic
901188045 1:7387566-7387588 GCCCCAGGAGGCACCTGGGCTGG - Intronic
901204924 1:7489155-7489177 GCCACAGGTGGGCCCTGGCCTGG + Intronic
901450527 1:9333896-9333918 GAGGCAGGTGGGGCCTGGCCAGG + Intronic
901631153 1:10648849-10648871 GTCCCAGGAAGGGCCTGGACAGG + Intronic
901828093 1:11875558-11875580 GGAACAGGAGGGGACTGGCCAGG - Intergenic
902387363 1:16083493-16083515 GCCCCAGGAGGGGCTGGGGCTGG + Intergenic
902624435 1:17668381-17668403 GAGCCAGGCAGGGCCTGACCCGG - Intronic
903211602 1:21822229-21822251 GACTCAGGAGGCCCCTGGCGGGG + Exonic
903270976 1:22188073-22188095 AACCCAGGAGAGGCCGGGCATGG - Intergenic
904208233 1:28868924-28868946 GACCCAGCAGGTGCCCAGCCTGG - Intergenic
904266076 1:29319254-29319276 GGCCAAGGAGGGGGCTGGGCGGG - Intronic
904563346 1:31413178-31413200 GGCCGGGGAGGGGCCAGGCCCGG + Intronic
904772640 1:32888871-32888893 GACCCAGGTGGGACTTGGCTCGG + Exonic
905205904 1:36342753-36342775 GGACCAGGAGGGGCCGTGCCTGG - Intronic
905561306 1:38929411-38929433 CACCCAGGAAGGCCCTGGCAAGG + Intronic
906155168 1:43609707-43609729 CACCTAAGAGGGTCCTGGCCTGG - Intronic
907326251 1:53640431-53640453 GACCCAGGGAGGGACAGGCCAGG - Intronic
907360853 1:53913415-53913437 GACCCAGAAGGGGACTGCTCTGG - Intergenic
912442824 1:109712229-109712251 GGCCCAGGAGGGGACAGGCGGGG - Intergenic
912547067 1:110458410-110458432 GACCCTGTGGGGGCCTGGCCTGG - Intergenic
912710082 1:111943848-111943870 GGCCCAGGAGTGGCATGGCCAGG + Intronic
912948651 1:114105503-114105525 TTCCCAGGAAGGGCCTGGCTGGG + Intronic
913091469 1:115479223-115479245 GCTCCAGGAGCGGCCTGGCAGGG + Intergenic
913592182 1:120340894-120340916 GAGTCAGGGGAGGCCTGGCCGGG + Intergenic
913615894 1:120558963-120558985 AACCCAGGCGGGGCGGGGCCGGG - Intergenic
913651176 1:120914252-120914274 GAGTCAGGGGAGGCCTGGCCGGG - Intergenic
914169936 1:145214815-145214837 GAGTCAGGGGAGGCCTGGCCGGG + Intergenic
914421017 1:147528418-147528440 GAAAGAGGAGCGGCCTGGCCTGG - Intergenic
914525053 1:148458778-148458800 GAGTCAGGGGAGGCCTGGCCGGG + Intergenic
914574385 1:148951939-148951961 AACCCAGGCGGGGCGGGGCCGGG + Intronic
914598623 1:149177052-149177074 GAGTCAGGGGAGGCCTGGCCGGG - Intergenic
914641350 1:149608356-149608378 GAGTCAGGGGAGGCCTGGCCGGG - Intergenic
915062140 1:153195066-153195088 GACCCAGAAGGGGACTGGCAGGG - Intergenic
915122833 1:153642295-153642317 GACCCATAGGGGCCCTGGCCAGG + Exonic
915206677 1:154275170-154275192 TTCCCAGGAGGGTCTTGGCCCGG + Exonic
915300249 1:154947600-154947622 GAGGCAGGTGGGGCCTGGCTGGG - Intronic
915331011 1:155112344-155112366 GTCCCAGGAGGGGCCATGGCAGG + Intergenic
915399679 1:155613088-155613110 GAATCAGGAAGGGACTGGCCTGG - Exonic
915416790 1:155748644-155748666 GAATCAGGAAGGGACTGGCCTGG - Intergenic
915929996 1:160054373-160054395 GACCCAGATGGGGCCAGGCTGGG - Intronic
916721764 1:167489755-167489777 AGCCCAGGAGGGGGCTGCCCTGG - Intronic
917254524 1:173100033-173100055 AACACAGGAGGGGCCGGGCGTGG - Intergenic
919905085 1:202072867-202072889 GATACAGGAGGTGCCTGGCCAGG + Intergenic
919934240 1:202241218-202241240 ACCCCAGGAGGGGCATGGGCAGG - Intronic
920032956 1:203048386-203048408 CACGGAGGAAGGGCCTGGCCAGG + Intronic
920452846 1:206073126-206073148 GACACAGGAGGAGCCAGGCATGG - Intronic
920535837 1:206736027-206736049 GGGCCAGGAGGGGTCTGGCATGG + Intergenic
920578877 1:207085987-207086009 GCCCCAGGAGGACCCTGTCCTGG + Intronic
920630379 1:207645848-207645870 GGGCGAGCAGGGGCCTGGCCAGG + Intronic
920641171 1:207752806-207752828 GGGCGAGCAGGGGCCTGGCCAGG + Intronic
921178717 1:212615082-212615104 GACCCAGGAGGGGACAGGCAGGG - Exonic
921390449 1:214608853-214608875 GCCCCGGTGGGGGCCTGGCCCGG - Intronic
922208312 1:223467988-223468010 TGCCTAGGAGGGGCATGGCCAGG - Intergenic
922746348 1:228046179-228046201 GATCCAGAGGGGGCCTGGCATGG + Intronic
923077719 1:230624801-230624823 GACTCAGGAGTGGGCTGCCCAGG - Intergenic
923092977 1:230753667-230753689 GACTGAGGAGGGGCCTGGGCTGG - Intronic
923700230 1:236293057-236293079 CCCCCAGGATGGGCCTGGCGCGG - Intergenic
1063465652 10:6242384-6242406 TGCCCAGGACGGGCCTGGCCAGG + Intergenic
1063662686 10:8044955-8044977 GACCCAGGGGGAGCCTGTCTTGG - Intergenic
1064003849 10:11684782-11684804 GACCCGGGAGTGGCCCTGCCTGG + Intergenic
1064418005 10:15167912-15167934 TCCCCAGCAGGGGCCGGGCCCGG + Intronic
1064461979 10:15544002-15544024 AAGCTAGGAGGGGCCAGGCCTGG + Intronic
1064981780 10:21173462-21173484 GACCCCGGAGGGACCAGGCTGGG - Intronic
1067088047 10:43253143-43253165 CCTGCAGGAGGGGCCTGGCCAGG + Intronic
1067479291 10:46584862-46584884 GAAACAGGAGGGGCAGGGCCTGG - Intronic
1067615448 10:47756939-47756961 GAAACAGGAGGGGCAGGGCCTGG + Intergenic
1069994911 10:72336169-72336191 GACCCTGGGGAGGCCTGACCAGG - Intronic
1070934702 10:80284131-80284153 GACACAGGAGGGGCCTTACGAGG + Intronic
1070954156 10:80453950-80453972 GGCGCAGGCCGGGCCTGGCCCGG - Intergenic
1071160297 10:82737799-82737821 GACCCGACAGGGGCCTGGCAGGG + Intronic
1071294809 10:84211792-84211814 GAGGCAGGAGGGGCCTGGGAGGG + Intronic
1071601374 10:86960148-86960170 GGCCCAGGAGAGGACTGGGCAGG - Intronic
1072439497 10:95441292-95441314 GAACCAGGAGTCACCTGGCCAGG + Intronic
1072810938 10:98461250-98461272 TACCCATGTGGGGCCAGGCCTGG - Intronic
1072943136 10:99785352-99785374 GGCCCAGGAGGGGCCAGGAGGGG + Intronic
1073116354 10:101094027-101094049 GGCACAGGAGGGGGCTGGCAGGG - Intronic
1073302920 10:102481810-102481832 GAGCATGGTGGGGCCTGGCCTGG - Intronic
1073499612 10:103924003-103924025 GAGCCTGGAGAGGCCAGGCCAGG - Intergenic
1074312039 10:112330318-112330340 GGACCGGGAGGGGCCTGGCTGGG + Intergenic
1074416267 10:113269571-113269593 GGCCAAGGAGTGGCCTGGCAGGG - Intergenic
1074591938 10:114821923-114821945 GATCGAGGCAGGGCCTGGCCCGG - Exonic
1074693545 10:116028249-116028271 GACAAATGAGGAGCCTGGCCTGG - Intergenic
1074772647 10:116743338-116743360 GACCCAGGGGGTGCCTGGCCAGG - Intergenic
1074941201 10:118237232-118237254 GACCAAGGTGGGGCCTGGGGTGG - Intergenic
1075520071 10:123137776-123137798 GACCCCGGAGGAGACTGGGCCGG + Intergenic
1075715668 10:124553829-124553851 GACAGAGGAGGGGCCTGGCCCGG - Intronic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1075762788 10:124869643-124869665 GACTCAGGTGAGGCCTGGCATGG - Intergenic
1076019116 10:127055962-127055984 GACCCAGCAGGAGCCAGGCATGG + Intronic
1076337817 10:129720374-129720396 GAGCCAGGAGGGGCCGAGGCTGG - Intronic
1076736636 10:132462028-132462050 GCCCAAGGAGGGGCCCGGCAGGG - Intergenic
1076784517 10:132743209-132743231 GCCCCAGCAGGGACCGGGCCCGG + Intronic
1076784536 10:132743267-132743289 GCCCCAGCAGGGACCGGGCCCGG + Intronic
1076784555 10:132743325-132743347 GCCCCAGCAGGGACCGGGCCCGG + Intronic
1076784573 10:132743384-132743406 GCCCCAGCAGGGACCAGGCCCGG + Intronic
1076784591 10:132743443-132743465 GCCCCAGCAGGGACCAGGCCTGG + Intronic
1076795663 10:132797041-132797063 GAACCTGGATGTGCCTGGCCTGG + Intergenic
1076806505 10:132861810-132861832 CACCTGGGAGGGGCCTGCCCAGG - Intronic
1076908747 10:133377165-133377187 GAACCAGGAACGGGCTGGCCAGG + Intergenic
1076934313 10:133557196-133557218 GCCCCAGGAGGGCACTGGGCTGG + Intronic
1076988765 11:258037-258059 GAGCCAGGATGGGCCAGGACGGG - Intergenic
1077014796 11:394738-394760 GGCACAGGTGGGGCCTGGCCAGG - Intronic
1077048926 11:558095-558117 GAGCCAGGCTGGGGCTGGCCTGG - Intronic
1077051563 11:568983-569005 GACCCGGGTGGGGCCTGCGCGGG + Intergenic
1077077210 11:707132-707154 GACCCAGGAGGGGCCGCGAGGGG - Intronic
1077145243 11:1041620-1041642 GAGGGAGGAGTGGCCTGGCCAGG - Intergenic
1077155688 11:1089894-1089916 GACGCAGGAGGGCTCAGGCCTGG - Intergenic
1077576440 11:3387143-3387165 GAGCCAGGGGGGGCCGGGCGCGG + Intergenic
1077786058 11:5384560-5384582 GATCCAGGGAGGGGCTGGCCTGG - Intronic
1078094361 11:8287583-8287605 GGCCCAGGAGGCTCCTGGCCTGG + Intergenic
1078296496 11:10076516-10076538 GGACCAGGAGGGGTGTGGCCTGG + Intronic
1078545955 11:12247129-12247151 GACACAGGAGAGCACTGGCCTGG - Intronic
1080271195 11:30452365-30452387 GCCACAGGATGGGCCTGGGCAGG - Intronic
1080596334 11:33777131-33777153 GACCCAGGAGAGCCCTTTCCTGG + Intergenic
1081087937 11:38824091-38824113 GCCCCCGGAGGGGCTTTGCCAGG - Intergenic
1081793601 11:45805216-45805238 GACGCGGGAGGGGGCTGGGCCGG - Exonic
1083306403 11:61764244-61764266 GGCCAGGGAGGGGCCTGGGCGGG + Intronic
1083369479 11:62166847-62166869 GAGGCAGGAGGGGTCTGGGCAGG + Intergenic
1083440392 11:62672216-62672238 GACCCCGGAGAGTCCTGGCATGG - Exonic
1083619366 11:64041413-64041435 GAACCAGGAGGGGCTTTTCCTGG + Intronic
1083844208 11:65321555-65321577 GTCCCAGGTGGGGCCCAGCCAGG + Exonic
1083931946 11:65850942-65850964 GCCACTGGTGGGGCCTGGCCTGG + Intronic
1084022897 11:66428425-66428447 GCCCCAGGAGGACCCTGGCATGG + Intergenic
1084033110 11:66492556-66492578 GACCCAGTAGGGCCCAGGCCTGG + Intronic
1084053296 11:66615215-66615237 GAGCCAGTATGGGCCAGGCCCGG - Intergenic
1084106997 11:66986698-66986720 GGACCAGGAAGGGCCTGGCGTGG + Intergenic
1084113782 11:67030187-67030209 GATCCAGGAGGGGTTTGCCCTGG - Intronic
1084256452 11:67946315-67946337 CCTCCTGGAGGGGCCTGGCCAGG - Intergenic
1084426499 11:69087032-69087054 GACCCTGGAGGGGCCGGGGATGG + Intronic
1084617488 11:70246234-70246256 GAGCCAGGAAGGGCCAGGCGTGG - Intergenic
1084707638 11:70824565-70824587 GCCCCTCGAGGGGCTTGGCCTGG + Intronic
1084797724 11:71519341-71519363 AGCCCAGGAGGGGCCTGGGAAGG - Intronic
1085035454 11:73297205-73297227 GGCCCAGGAGCGGCGTGGCAAGG + Exonic
1085130213 11:74031842-74031864 GATCCAGGATGGGCAAGGCCAGG + Intronic
1085510654 11:77086537-77086559 GGCCCAGGAGCCTCCTGGCCTGG + Intronic
1085526321 11:77166292-77166314 GCTCCAGGAGGGGCCTGGAGGGG + Intronic
1089134576 11:116238880-116238902 CACTGAGGATGGGCCTGGCCAGG + Intergenic
1089297194 11:117476884-117476906 GACCCAGGATGGGTGTGGCCTGG + Intronic
1089498574 11:118919939-118919961 GACCCAGCAGGGGGAGGGCCTGG - Intronic
1090171947 11:124613071-124613093 TAAGCAGGACGGGCCTGGCCAGG + Exonic
1090664378 11:128905237-128905259 GAGCCAGGAGGGGCCTGCGGAGG - Intronic
1091219051 11:133919844-133919866 GGCCCAGCAGGGGCGGGGCCGGG + Exonic
1091793173 12:3283108-3283130 GACGCATGAGCGGGCTGGCCGGG + Exonic
1092246626 12:6867691-6867713 CGCCGAGGAGGGGTCTGGCCGGG + Intronic
1096215287 12:49795021-49795043 GAACAAGGAGGGGGCTGGCGGGG - Exonic
1096528841 12:52231035-52231057 GAGGCAGGAGGAGACTGGCCAGG + Intergenic
1096556746 12:52408558-52408580 GACACAGGAGGAGGCTGGCGTGG - Intergenic
1096622810 12:52874864-52874886 AACCCCTGAGGGGCCTGTCCTGG - Intergenic
1097037036 12:56130799-56130821 GGCCCAGGAAGGGCCAGACCTGG - Exonic
1097191965 12:57223794-57223816 GAGGCAGGAGCGGCCGGGCCAGG - Intronic
1097288137 12:57893379-57893401 GACCCTGGAAGAGCCTGGCATGG + Intergenic
1097383193 12:58920008-58920030 GACCCAGGACGGGAGTGGCTCGG + Exonic
1097601098 12:61694426-61694448 GACCCAGGATGGCCCTGGGCTGG + Intergenic
1097663384 12:62454590-62454612 GAGCCAGGAAGGGCCAGGCATGG + Intergenic
1097865989 12:64559557-64559579 GACCCACAAGGGGCCAGGCGCGG - Intergenic
1101903944 12:108811664-108811686 CACCCAGGACAGGCCAGGCCGGG - Intronic
1102028244 12:109725611-109725633 GACCCAGGTGAGACCAGGCCAGG + Intronic
1102162387 12:110780146-110780168 GAGCCTGGAGGGGCTTGGCGAGG + Intergenic
1103008274 12:117438958-117438980 GGCCAAGGAGGGCCCTGGCCAGG - Intronic
1103392454 12:120584539-120584561 GGGCCAGAAGGGGCCGGGCCTGG - Intergenic
1103480772 12:121248542-121248564 GCCTGAGGTGGGGCCTGGCCAGG - Intronic
1103518110 12:121520588-121520610 GACCTTGGAAGGGCCTGTCCTGG - Intronic
1103942901 12:124510579-124510601 GACACAGGAGGTGGCTCGCCTGG - Intronic
1103954300 12:124567723-124567745 GAGCCAGAGGGGGCCGGGCCGGG - Intergenic
1104692835 12:130839327-130839349 GAGCCCGGAGGGGCGGGGCCTGG + Intergenic
1104873280 12:132015852-132015874 GGCCCAGGAGCGTCCTGTCCTGG + Intronic
1104912384 12:132245556-132245578 GACCACGGAGGGCCCTGGCTGGG - Intronic
1104912406 12:132245616-132245638 GACCACGGAGGGCCCTGGCTGGG - Intronic
1104954354 12:132457213-132457235 GACGGAGGGAGGGCCTGGCCCGG + Intergenic
1104954361 12:132457231-132457253 GCCCCAGGAGTGGCCCGTCCGGG - Intergenic
1104981688 12:132575835-132575857 GGACCAGGAGGGGCCGGCCCAGG + Intronic
1105034357 12:132908242-132908264 GACCTAGGATGGGGCTGGCCTGG + Intronic
1105896067 13:24718346-24718368 GGCACGGGAGGGGCCTGGTCAGG + Intergenic
1105984366 13:25550705-25550727 GAGTCAGGAAGGGCCTGGACAGG - Intronic
1106028668 13:25978649-25978671 GACTCAGGAGAGGCCGGGCGCGG + Intronic
1106248669 13:27968326-27968348 GCGCCAGGAGGGGCACGGCCCGG - Intronic
1107061709 13:36166505-36166527 GACCCTGTAGGGGTATGGCCTGG + Intergenic
1108409114 13:50129968-50129990 GACCCAGGCGGGGCCCGGGGTGG + Intronic
1110169641 13:72485234-72485256 GTCACAGGAGGGGCCTGGTGGGG + Intergenic
1110484265 13:76019773-76019795 GACCCAGAAGGGGCATGGAGCGG + Intergenic
1112190893 13:97176150-97176172 GACCCAGCATGTCCCTGGCCAGG - Intergenic
1112349625 13:98622049-98622071 GCGCCAGGATAGGCCTGGCCTGG - Intergenic
1113368425 13:109700276-109700298 GGCCCAGGAGGGGCGTGGGCAGG + Intergenic
1113451683 13:110414447-110414469 GTCCCAGGACTGGCCTGGGCTGG - Intronic
1113799118 13:113077416-113077438 GGCACAGGATGGGCGTGGCCGGG - Intronic
1114193003 14:20454847-20454869 GTCCCTGGAGGGGCCTTGGCGGG - Exonic
1114556447 14:23565103-23565125 GGCCCAGGTGGGGCCTGGGAGGG - Exonic
1115822116 14:37223789-37223811 CACCCAGGAGGGGCCAGGCAGGG - Intronic
1117694096 14:58340773-58340795 GACACAGGTGGGGCCGGGCACGG - Intronic
1118159422 14:63273838-63273860 GAGCCAGGTGCAGCCTGGCCAGG + Intronic
1118256694 14:64211590-64211612 GCCCCCTGAGGGGCCAGGCCAGG - Intronic
1120863174 14:89273303-89273325 ACCCCAGCAGGGACCTGGCCTGG + Intronic
1121280256 14:92692620-92692642 GACACTGAAGAGGCCTGGCCTGG + Intergenic
1121341304 14:93106746-93106768 CACCCAGCACAGGCCTGGCCAGG + Intronic
1121445805 14:93978037-93978059 AACCTAGGAGGGGCCTGGCCTGG - Intergenic
1121781245 14:96623870-96623892 GCGCCAGGAGGGGCTTCGCCAGG - Intergenic
1122227223 14:100286798-100286820 GAACCAGAGGGGGCCTGGCCAGG - Intergenic
1122275072 14:100587069-100587091 GGCCCGGGAGGAGCCGGGCCGGG - Intronic
1122791899 14:104187529-104187551 GCCCCAGGAGGGTGCTGTCCAGG + Intergenic
1122825721 14:104369534-104369556 GACCCTGGTGGGGCTGGGCCTGG - Intergenic
1122830604 14:104393792-104393814 GACCCTGGAGAGACCTGGCCAGG + Intergenic
1122851050 14:104531344-104531366 GTCCCAGGAAGGGCCCGTCCAGG + Intronic
1122874194 14:104655862-104655884 GAGCCAGGAGGGGCGTGATCAGG + Intergenic
1123019605 14:105391526-105391548 CCCCCAGGAGCTGCCTGGCCTGG + Intronic
1123038916 14:105482550-105482572 TACCTTGGAGGGACCTGGCCAGG - Intergenic
1202904257 14_GL000194v1_random:59481-59503 GCCCCTGAGGGGGCCTGGCCTGG - Intergenic
1123691015 15:22838466-22838488 GATCCAGGCGGGACCTGGCGAGG - Intergenic
1124349316 15:28943769-28943791 GCCCAAGGAGGGGCCAGGGCTGG - Intronic
1124370273 15:29100723-29100745 GGCCCAAGAGTGGCCTGGCCTGG - Intronic
1128150797 15:65362465-65362487 GAGACAGGAGGTGCCTGGCTTGG - Intronic
1128502096 15:68233751-68233773 CAGCCAGGAGGGGCCTGACTAGG + Intronic
1129319680 15:74767682-74767704 GGACTAGGAGGGGACTGGCCTGG - Intergenic
1129320108 15:74770008-74770030 GTGCCAGGAGGGACCTGGCATGG - Intergenic
1129389865 15:75215092-75215114 GATACAGGAGGGGCCTGCCCTGG - Intergenic
1129436791 15:75547954-75547976 TACCCAGTAGGGGCCAGGCATGG - Intronic
1129662016 15:77558169-77558191 GGGTAAGGAGGGGCCTGGCCTGG + Intergenic
1129671017 15:77607715-77607737 GGCCCAGCAGGGACCAGGCCAGG + Intergenic
1130994544 15:88896554-88896576 GACCAATGGGGGCCCTGGCCTGG + Intergenic
1131063128 15:89416688-89416710 GTTCCCGGCGGGGCCTGGCCTGG + Intergenic
1131260460 15:90884868-90884890 TACCCAGCAGCAGCCTGGCCTGG - Intronic
1132083919 15:98891241-98891263 GACCCAGAAGGATGCTGGCCAGG + Intronic
1132292355 15:100712522-100712544 GAGCAAGGCTGGGCCTGGCCGGG - Intergenic
1132381541 15:101369861-101369883 GCACCAGCAGGGGCCTGTCCCGG - Intronic
1132665253 16:1078548-1078570 CACCCAGATGGCGCCTGGCCTGG - Intergenic
1132673504 16:1112265-1112287 GACCCAGGCGGGGCCTCCGCTGG - Intergenic
1132720778 16:1314621-1314643 GAAGCAGGCTGGGCCTGGCCGGG + Intronic
1132880300 16:2159159-2159181 GACGCTGGAGAGGCTTGGCCAGG + Intronic
1133184971 16:4089586-4089608 AACCCAGGAGTGGCATGGCTGGG + Intronic
1133236610 16:4390195-4390217 GACCCAGGAGAGCCCCAGCCTGG + Intronic
1133332991 16:4987872-4987894 GGCCCAGGAGGGGCGAGGGCTGG + Intronic
1133371586 16:5249344-5249366 CCTCCTGGAGGGGCCTGGCCGGG + Intergenic
1134656963 16:15954536-15954558 GACCCGGGAGAGGCCTGGGCAGG + Intronic
1135323620 16:21512551-21512573 GACCCCCGAGGGCCCAGGCCAGG - Intergenic
1135544108 16:23354338-23354360 CCCCCAGGAGTGGGCTGGCCGGG + Intronic
1136136436 16:28259299-28259321 GACCCTGGAGCGCCCTGGCTCGG + Intergenic
1136335106 16:29605816-29605838 GACCCCCGAGGGCCCAGGCCAGG - Intergenic
1136406862 16:30053258-30053280 GACTGAGGAGGGGAGTGGCCTGG + Intronic
1137598466 16:49740363-49740385 GCCCCGGGAGGGGTGTGGCCAGG + Intronic
1137613256 16:49833099-49833121 GTCCCATGAGGGGCCAGGCCTGG - Intronic
1137621021 16:49876667-49876689 GACACAGGAGGGAGCTGGGCGGG + Intergenic
1138360759 16:56425460-56425482 CAGCCAGGAGCGGCCCGGCCCGG - Exonic
1138415836 16:56870795-56870817 GACCAGGGAGGGCCCAGGCCTGG - Intronic
1138457868 16:57131713-57131735 GGGCCAGGAGGGGCCAGGCCTGG - Intronic
1138515382 16:57533158-57533180 CCCCTAGGAGGGGCCTGGCCAGG - Intronic
1139503492 16:67387308-67387330 AACCTAGCAGGTGCCTGGCCTGG - Intergenic
1139834541 16:69827738-69827760 GAGCCAGGCAGGGCCTGGGCAGG + Intronic
1139961833 16:70722328-70722350 GCCCTCGGAGGGGCCTGGCCTGG - Intronic
1140898967 16:79350725-79350747 GACCCTGCAGGGACCTGCCCTGG + Intergenic
1141421170 16:83917506-83917528 GACAGAGAAGGGGCCTGGCGAGG - Exonic
1141665704 16:85464091-85464113 CAGCCAGGAGGGGCCAGGCATGG - Intergenic
1141691617 16:85599991-85600013 CACACAGGAGGGACCTTGCCAGG - Intergenic
1142176882 16:88649549-88649571 GCCCCAGGAGGCAGCTGGCCCGG - Intronic
1142199114 16:88752810-88752832 GACCCACCACGGGCCTGCCCTGG + Intronic
1142200399 16:88758358-88758380 GCCCCAGCAGTGGCCTGGCCTGG + Intronic
1142285153 16:89168639-89168661 AACACAGGTGGGCCCTGGCCGGG - Intergenic
1142408235 16:89902969-89902991 CCCCCCAGAGGGGCCTGGCCAGG + Intronic
1142501915 17:337788-337810 GCCCCATGAGGGGCCTTGCCGGG - Intronic
1142574403 17:896934-896956 GGCCTAGGAGGGGACTGGCTTGG - Intronic
1142716148 17:1748007-1748029 GATCCAGGAGGGGCTGGGCGCGG + Intronic
1143001741 17:3799021-3799043 AATCCAGGACTGGCCTGGCCTGG - Intronic
1143259027 17:5584540-5584562 AACCCACAAGGGGCGTGGCCAGG + Intronic
1143323160 17:6080942-6080964 GAGCCAGCGGGGGCCGGGCCGGG - Exonic
1143514934 17:7414795-7414817 GACGCAGGAGGCCCCTGCCCCGG - Exonic
1143560754 17:7693029-7693051 GACCCAAGAGGGGCTGGGCGCGG - Intronic
1144710579 17:17399123-17399145 GACCTGGGTGGGGCCTGGCAGGG - Intergenic
1145007610 17:19346375-19346397 CACCCAGCAGGGCTCTGGCCTGG + Intronic
1145274483 17:21421649-21421671 GCCCCAGCTGGGGCCTGCCCTGG + Intergenic
1145875324 17:28314908-28314930 GGCCCAGGAGAGGTCTGGCTAGG - Intergenic
1145909627 17:28534949-28534971 GGTCCAGGAGGGGCCAGGCCTGG - Exonic
1146265371 17:31449313-31449335 GACCCAGCAGGGGCGTGGTGCGG - Intronic
1146581222 17:34040181-34040203 GGCGCAGGAGGGCCCAGGCCAGG + Intronic
1147134738 17:38428411-38428433 GACCCGGGAGGGGCGGGGCCGGG - Exonic
1147143783 17:38473883-38473905 TACCCAGGAAGAGCCTGTCCAGG + Intronic
1147262770 17:39218203-39218225 GAGCCTAGAGGGGGCTGGCCAGG + Intronic
1147646853 17:42039493-42039515 GGCTCAAGAGGGGCCTGGGCGGG - Intronic
1147732709 17:42614020-42614042 GGCCCAGGGCCGGCCTGGCCTGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148804613 17:50257886-50257908 GGGGCAGGCGGGGCCTGGCCGGG + Intergenic
1148807854 17:50273272-50273294 GAGCCGGGAGGGGCGCGGCCGGG - Intronic
1149145543 17:53487930-53487952 GAGCCAGGAGAGGATTGGCCAGG - Intergenic
1150108537 17:62478956-62478978 GGCGCAGGAGGGCCCAGGCCGGG - Intronic
1151309250 17:73283455-73283477 GACTCTGAAGGGGCCTGCCCAGG + Intergenic
1151336318 17:73441791-73441813 GACCCATGAGGTTCCTGGTCAGG - Intronic
1151414461 17:73952538-73952560 GACCCAGGAGCCTCCTGGCCTGG - Intergenic
1151475042 17:74340501-74340523 GACACAGAAGGGTCCTGGCCGGG - Intronic
1151564287 17:74888934-74888956 GACCCAGGACAGGGCTGGGCAGG + Intronic
1152299017 17:79484659-79484681 GCTCCAGGAAGGGGCTGGCCTGG + Intronic
1152407938 17:80108121-80108143 GACTCAGGAGGAACCTGGCATGG - Intergenic
1152538204 17:80962400-80962422 GCCCCATGAGGGGCCTGGCCAGG - Intronic
1152569738 17:81116434-81116456 GAGGCAGGAGGGGCCTGGGGAGG - Exonic
1152630425 17:81408458-81408480 GCCCCAGGAGGGGCAGGGCACGG - Intronic
1152693124 17:81730316-81730338 GAGCTGGGAGGGGCCTGGACAGG + Intergenic
1152797967 17:82317229-82317251 GACCCCGGTGGGGAGTGGCCGGG - Intronic
1152884212 17:82839769-82839791 GACCCAGCAGGTGCATGGCTGGG - Intronic
1152932289 17:83116000-83116022 GAGCTCGGAGGGGCCTGCCCCGG + Intergenic
1153408711 18:4769744-4769766 GACACAGGAGGGGCCTTACCAGG + Intergenic
1155166725 18:23237841-23237863 GACACCAGAGGGGCCTGGCGGGG + Intronic
1157244600 18:46042031-46042053 GACCCAGCAGGACCCAGGCCTGG + Intronic
1157472259 18:47998992-47999014 GATCCTGGAGAGGCCTGGCAGGG - Intergenic
1157626702 18:49056835-49056857 GACCCAGGTGTGGCCGGGCGCGG - Intronic
1157719364 18:49912022-49912044 GCTCCAGGAGAGGCCTGACCAGG - Intronic
1157730545 18:50000693-50000715 GACACAGATGGGGCCTGCCCTGG + Intronic
1158532744 18:58278348-58278370 GAGGCAGGAGGGGCAGGGCCTGG - Intronic
1158536994 18:58317211-58317233 GCCACGGGAGGGGCCTGCCCAGG + Intronic
1158691542 18:59665725-59665747 TACCCAGGAAGAGCGTGGCCTGG - Intronic
1159586842 18:70289561-70289583 GTCCGAGGAGGGACCCGGCCGGG - Intronic
1159742543 18:72190413-72190435 GACCCAGAATGGGCCAGGCGCGG - Intergenic
1160299625 18:77668317-77668339 ACCCCGGGAGCGGCCTGGCCTGG + Intergenic
1160554411 18:79716664-79716686 GGCCAAGGAGGACCCTGGCCTGG - Intronic
1160580673 18:79883161-79883183 GACGCGGGAGAGGCCAGGCCAGG + Intronic
1160765264 19:804759-804781 CACACGGGAGGGGCCTGGCAGGG + Intronic
1160847254 19:1172068-1172090 GAGCCAGGAGGGCCCTGGTGTGG - Intronic
1161289467 19:3485227-3485249 GAGCCAGGAGGGGACTGAGCTGG + Intergenic
1161364084 19:3868507-3868529 GACCTGGGAGGTGCCTGGCCGGG - Intronic
1161395602 19:4043566-4043588 GACTTTGGAGGGGCCAGGCCTGG - Intergenic
1161399242 19:4060143-4060165 AGCCCAGGAGGGGCCTGCCAGGG - Intronic
1161667550 19:5586301-5586323 GCCCCTGGAGGGCCCTGGCACGG + Intergenic
1161961337 19:7524998-7525020 GACCCAGGCGGGGCCTTCACCGG + Exonic
1161994607 19:7704537-7704559 CAACCAGGAGGGGGCTGGGCTGG - Intergenic
1162020952 19:7868427-7868449 GGTGCAGGAGGGGCCTGGCAGGG - Intergenic
1162910073 19:13843563-13843585 GACCCAGGGGCTGCATGGCCTGG - Intergenic
1163390338 19:17026820-17026842 GTCCGGGGAGGGGGCTGGCCCGG - Intergenic
1163638178 19:18447179-18447201 GAGGCAGCAAGGGCCTGGCCTGG - Intronic
1163683900 19:18699887-18699909 GGCCTAGGAGGGGCCAGGGCAGG + Intronic
1163700739 19:18785386-18785408 GGGCCAGAAGGGGGCTGGCCCGG - Intronic
1163861935 19:19747371-19747393 GTCCCAGCAGGGGCCAGACCTGG + Intergenic
1164542446 19:29131013-29131035 GCCCTAGGAAGGGCCTGGGCTGG + Intergenic
1164840494 19:31389212-31389234 GGCCCAGCAGGGGCCAGGGCTGG + Intergenic
1165632290 19:37312194-37312216 GACCCAGAAGGGGCCTGATGGGG - Intergenic
1165828603 19:38719525-38719547 GAGGGAGGAAGGGCCTGGCCAGG + Intronic
1165897970 19:39154886-39154908 GTCCAAGGAGGGGCTGGGCCAGG - Intronic
1166046390 19:40233227-40233249 GAACCAGGAGTGGCCGGGCTGGG - Exonic
1166252971 19:41584277-41584299 GAACCATGAGGGGCCTTGCAGGG - Intronic
1166304079 19:41927966-41927988 GCCCCAGGAGGGGGCGGGCGCGG - Intronic
1166411150 19:42555974-42555996 GAACCATGAGGGGCCTTGCAGGG + Intronic
1166442095 19:42823893-42823915 GAACCAGGAGAGGCAGGGCCCGG + Intronic
1166461519 19:42992176-42992198 GAACCAGGAGAGGCAGGGCCCGG + Intronic
1166478812 19:43152161-43152183 GAACCAGGAGAGGCAGGGCCCGG + Intronic
1166488804 19:43239450-43239472 TACCCAGGAGTGGAATGGCCAGG + Intronic
1166501485 19:43344492-43344514 GAACCAGGAGAGGCAGGGCCCGG + Intergenic
1166508631 19:43388966-43388988 GAACCAGGAGAGGCAGGGCCCGG - Intergenic
1166685327 19:44793190-44793212 GAGCCTGGAAAGGCCTGGCCCGG + Intronic
1166750557 19:45162313-45162335 GACCCAGGCAGGGCCTGACGGGG + Intronic
1166793132 19:45409604-45409626 CAGCCAGCAGGAGCCTGGCCTGG + Exonic
1167011726 19:46813191-46813213 CTCCCAGGAGGGGCCTGGAGGGG + Intergenic
1167077621 19:47258916-47258938 GACCCTGGAGGGGGCAGGCCTGG - Intronic
1167279778 19:48560108-48560130 GACCGGGGAAGGGCCTGACCTGG + Intronic
1167291852 19:48629096-48629118 GAGCCAGGAGAGGCCAGGGCAGG - Exonic
1167299017 19:48668584-48668606 TACCCAGCAGGAGCCTGGCAGGG + Intronic
1167302084 19:48683890-48683912 AACACAGGAGGGGCCAGGCACGG + Intergenic
1167426894 19:49434178-49434200 GAGCGAGGAGGGGCTAGGCCTGG - Intronic
1168115918 19:54221332-54221354 GACCCTGCAGGGCCCTGTCCTGG - Exonic
1168118901 19:54241080-54241102 GACCCTGCAGGGCCCTGTCCTGG - Exonic
1168407717 19:56119691-56119713 CACCAGGGAGGGGCCAGGCCGGG + Intronic
1168641472 19:58034303-58034325 GGCCCGGGAGGGGGCGGGCCGGG + Intronic
925117130 2:1389126-1389148 CACTCAGGAGGGGCAGGGCCTGG + Intronic
925289439 2:2737413-2737435 TACACAGGAGGGGCCTGCCAGGG - Intergenic
925394210 2:3520730-3520752 GAGCTAGGAGGGGCCTGGGAAGG - Intergenic
926121157 2:10241795-10241817 GGCTCAAGACGGGCCTGGCCTGG - Intergenic
926619743 2:15036871-15036893 ATCCAAGGAGGGGCCTGGGCAGG + Intergenic
927349662 2:22094404-22094426 GACCCAGAATGGACCTGGCAAGG - Intergenic
927847933 2:26480872-26480894 GGCCCAGCAGGAGCCGGGCCCGG + Exonic
928127225 2:28625247-28625269 TACCAAGGAGGCGCCTGCCCTGG + Intronic
928309484 2:30197666-30197688 GCCCCAGGAGTGGCCTGCTCAGG + Intergenic
929449754 2:42028800-42028822 GACCCAGATGGGGGCTGGGCAGG - Intergenic
929498612 2:42469833-42469855 CTCCCAGGAAGGGCCTGTCCTGG + Intronic
929943574 2:46353356-46353378 AACCCAGCAGGGGCCCGTCCAGG + Intronic
929950539 2:46406536-46406558 GACCCAGGAGGGGCATTGTGAGG - Intergenic
930753552 2:54954348-54954370 GGGCCAGGAGGAGGCTGGCCAGG + Intronic
930841074 2:55845914-55845936 GTGCCAGGATGGGCCTGTCCTGG + Intergenic
931257203 2:60584088-60584110 TGAACAGGAGGGGCCTGGCCGGG + Intergenic
932469124 2:71942452-71942474 GACCCCAGAGGGGCCTGCCTGGG + Intergenic
932733805 2:74239915-74239937 GACCCAAGAGGGGACTGACAAGG - Intronic
934035637 2:88086568-88086590 AAGCAGGGAGGGGCCTGGCCTGG - Intronic
934079190 2:88452730-88452752 GGCCCAGGAGGAGCCGCGCCGGG - Intergenic
934618833 2:95791909-95791931 GCCCGAGGAGGGCCCTGACCTGG + Intergenic
934642060 2:96032648-96032670 GCCCGAGGAGGGCCCTGACCTGG - Intronic
934655602 2:96115504-96115526 GGCCAAGGGGGGGCCTGGGCAGG - Exonic
934662578 2:96150964-96150986 GACCCATGTGGACCCTGGCCAGG - Intergenic
936077063 2:109408326-109408348 GACCCATGATGGCCCTGGACGGG + Intronic
936082040 2:109438868-109438890 TAACCAGAAGGGACCTGGCCTGG - Intronic
936086373 2:109472298-109472320 GGCCCGGGAGGCCCCTGGCCGGG - Intronic
936259219 2:110943794-110943816 GACCCAGGTATGTCCTGGCCTGG + Intronic
937258775 2:120572418-120572440 GACCCAAGAAGGGCCTGGCACGG + Intergenic
937310886 2:120902677-120902699 CACCCAGGAGGGACCCGGCGAGG - Intronic
937345344 2:121121918-121121940 TACCCAAGAGGCCCCTGGCCTGG - Intergenic
937427304 2:121811049-121811071 GGCCTCGGAGGGGACTGGCCTGG + Intergenic
937909784 2:127069870-127069892 GAGGCAGGAAGCGCCTGGCCCGG - Intronic
938125107 2:128665462-128665484 GACCCAGGAAGGGCAGGGACAGG - Intergenic
943365984 2:186967901-186967923 AACCAGGGAGGGGCCTGTCCAGG - Intergenic
946410452 2:219512915-219512937 GACCCTGATGGGGCCTGACCTGG + Intergenic
947436346 2:230075987-230076009 GGCCCAGCTGGGGACTGGCCTGG - Intergenic
947623193 2:231604081-231604103 CACCCAGGGGTGGCCTGGCCTGG + Intergenic
948188269 2:236038431-236038453 GAGTCAGGAGGAGCCTGGCAAGG - Intronic
948229266 2:236337613-236337635 GAGCGAGGAGGAGCCTGGGCTGG - Intronic
948746299 2:240096282-240096304 AAGCCAGGAGGGGGCTGGACGGG - Intergenic
948894435 2:240921725-240921747 GACCCTGGAGGAGCCGGGCGGGG - Intronic
948896368 2:240929784-240929806 GCCCCAGCAGGGGCCAGGCCTGG + Intronic
948911958 2:241009348-241009370 GCCCCAGGGTGTGCCTGGCCTGG - Intronic
949064784 2:241983493-241983515 GAGCCGGGAGGGCCCTGGCGTGG + Intergenic
949077530 2:242070620-242070642 GACCATGGAGGGGCCTAGCCAGG - Intergenic
1168842280 20:917075-917097 GCCCCAGGATGGCCCTGGCTTGG + Intergenic
1168863009 20:1059663-1059685 GCCCCAGGAAGGGCATGGCCTGG + Intergenic
1169278610 20:4249307-4249329 GACCGAGGAGGGGCAGCGCCAGG + Intergenic
1169330770 20:4714381-4714403 GACCCAGCAGGGGCCAGGCATGG + Intergenic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1171385480 20:24766951-24766973 GGCCCAGGAGGGGCCTCCTCTGG + Intergenic
1171481647 20:25459612-25459634 CACCCAGGAAGGCTCTGGCCCGG + Intronic
1172520120 20:35560700-35560722 GAAGCAGGAGGGACCTGGGCCGG + Intergenic
1172617776 20:36300470-36300492 TACCCAGGAGGGGCTGGACCTGG + Intergenic
1172670889 20:36633771-36633793 GACTCAGGAGGTACCTGGACAGG - Intronic
1173567327 20:44051350-44051372 GACCCAGCAGGGGCCCGGGCCGG - Exonic
1173880194 20:46406300-46406322 GACCCAGAAGGGGCGTCGCGTGG - Intronic
1174452529 20:50628962-50628984 CACACAGGAGGGACCTGGCCTGG + Intronic
1174940275 20:54919198-54919220 AAACCAGGAGGGGCCGGGCGCGG + Intergenic
1175284127 20:57826335-57826357 GAGCCAGGAGGCTGCTGGCCAGG - Intergenic
1175787694 20:61722505-61722527 CCCCCAGGAGGGGCCTTACCAGG + Intronic
1175899259 20:62353604-62353626 GGCCCAGGCAGGGACTGGCCAGG + Intronic
1175995710 20:62811482-62811504 GATCCAGGAGCGGCTTGTCCGGG + Exonic
1176111154 20:63411387-63411409 CAGCCAGGAGGGGCCTGTCCAGG + Intronic
1176241847 20:64079112-64079134 TTCCCTGGAGGGGCCAGGCCAGG - Intronic
1176290798 21:5043637-5043659 GACCCAAGATGGGGCAGGCCAGG + Intergenic
1176516693 21:7789559-7789581 GCCCCAGGAGGGTGCTGGCCTGG + Intergenic
1176604770 21:8819991-8820013 GACAGAGGAGGAGCCGGGCCAGG + Intergenic
1176623628 21:9074248-9074270 GCCCCTGAGGGGGCCTGGCCTGG - Intergenic
1178650721 21:34419571-34419593 GCCCCAGGAGGGTGCTGGCCTGG + Exonic
1179617886 21:42593577-42593599 GCCCCAGGAGGGGCTTGCCGGGG - Intergenic
1179708029 21:43193813-43193835 GAACCAGGAGGGGCCTCGCCAGG - Intergenic
1179719877 21:43309063-43309085 GACCGAGGAGGGGCATGGGGAGG - Intergenic
1179866457 21:44220004-44220026 GACCCAAGATGGGGCAGGCCAGG - Intergenic
1180019895 21:45116245-45116267 GCCCCAGGGTGGGGCTGGCCTGG + Intronic
1180075375 21:45459145-45459167 TTCCCAGGTGTGGCCTGGCCGGG + Intronic
1180075395 21:45459205-45459227 AACCCAAGAGGAGCCTGGGCTGG - Intronic
1180205488 21:46256826-46256848 GGTCCAGGAGGCCCCTGGCCAGG + Exonic
1180225644 21:46390541-46390563 CACCCAGGCAGGGCCAGGCCAGG - Intronic
1180347060 22:11711596-11711618 GACAGAGGAGGAGCCGGGCCAGG + Intergenic
1180354809 22:11829686-11829708 GACAGAGGAGGAGCCGGGCCGGG + Intergenic
1180383442 22:12162645-12162667 GACAGAGGAGGAGCCGGGCCGGG - Intergenic
1180920317 22:19518322-19518344 GCCCCAGGATGGGGCTGGCCTGG - Intronic
1180948133 22:19708033-19708055 GACCCAAGCGGGGCCTTGCAGGG - Intergenic
1181370058 22:22408843-22408865 GACCCAGGATGGGGCTGAACTGG + Intergenic
1181403424 22:22665602-22665624 GAACCAGCAGGAGCCAGGCCAGG + Intergenic
1181408427 22:22701587-22701609 GAACCAGCAGGAGCCAGGCCAGG + Intergenic
1181413750 22:22745086-22745108 GAACCAGCAGGAGCCAGGCCAGG + Intronic
1181559319 22:23690884-23690906 GTCCCAGGAGGGGCCCAGGCAGG - Exonic
1181863799 22:25839864-25839886 GAACCAGGAGGGGACTTTCCAGG - Intronic
1182062434 22:27407646-27407668 CTCCCAGCAGGGGCCTGGCCAGG + Intergenic
1182105552 22:27686529-27686551 GGCCCAGGAGGGTCATGCCCTGG - Intergenic
1182299509 22:29329835-29329857 GACCCAGGAGGGGCAGTGTCTGG + Intronic
1182422935 22:30257399-30257421 GAAGCAGAGGGGGCCTGGCCCGG - Intergenic
1182622466 22:31625618-31625640 GAGGCTGGAGGAGCCTGGCCTGG - Intronic
1183186623 22:36295148-36295170 GACCAAAGAGAGGCCTGGCCAGG + Intronic
1183363357 22:37394438-37394460 GGCCCCTCAGGGGCCTGGCCCGG + Intronic
1183470996 22:38006679-38006701 CCCCCAGGAAGGGCCTGGCTTGG + Intronic
1183491736 22:38120544-38120566 AGCGCAGGAGGGGCGTGGCCTGG - Intronic
1183739615 22:39662524-39662546 GGCCCACGGGGGGCGTGGCCGGG + Intronic
1184388157 22:44187923-44187945 GGCCCTGGAGGGGCCAGGTCAGG - Intronic
1184680811 22:46071381-46071403 AACCCAGGAGGGGCGGCGCCCGG + Intronic
1185051350 22:48555872-48555894 GACCTGGGAGGGGCTGGGCCTGG + Intronic
1185066658 22:48635646-48635668 GACACAGGAGGAACCAGGCCAGG - Intronic
1185113465 22:48917732-48917754 GACCCAGGGACAGCCTGGCCCGG + Intergenic
1185194748 22:49462063-49462085 GAACCCAGACGGGCCTGGCCTGG + Intronic
1185277942 22:49957799-49957821 GACACAGGAAGGGGCTGGGCTGG + Intergenic
950101128 3:10357667-10357689 GACCCAGCCAGGGCCTGGCCAGG + Intronic
950185164 3:10940238-10940260 GACCCAGGAAGGGCCAGGCTGGG + Exonic
950451505 3:13068125-13068147 GGCCCAGCAGGGTCCTGCCCCGG + Intronic
950499651 3:13355550-13355572 CAGGCAGGCGGGGCCTGGCCAGG - Intronic
952970091 3:38645289-38645311 GACCCACGACAGGGCTGGCCAGG - Intronic
953268476 3:41416391-41416413 GACCCAGGAGAGTCCCTGCCAGG - Intronic
953577050 3:44121167-44121189 TGTCCTGGAGGGGCCTGGCCCGG - Intergenic
953817160 3:46168407-46168429 GACAAAGAAGGGGCCTGGCGCGG - Intronic
954320259 3:49827773-49827795 GACCCAGCATGGGCCTGGCACGG - Intergenic
954864029 3:53713773-53713795 CTCCAAGTAGGGGCCTGGCCCGG + Intronic
955317875 3:57953785-57953807 GAACCAGGAGGGGTCAGGCCCGG + Intergenic
956675702 3:71730059-71730081 GGCACAGGAAGGGACTGGCCTGG + Intronic
960173004 3:114485066-114485088 GACCCAGGAGGGGCAGAGTCAGG - Intronic
960947695 3:122978187-122978209 GGCCCAGGTGGGGCCAGGCCTGG - Intronic
961200699 3:125043246-125043268 GACCCAGGGGAGGCCTGGCCTGG + Intronic
961365886 3:126398952-126398974 GAACCAGGCCTGGCCTGGCCAGG - Intronic
961634027 3:128321673-128321695 CACCCAGGAAGGGCCTTCCCAGG + Intronic
961739068 3:129021091-129021113 GACACATGAGGGGCCCTGCCAGG + Intronic
963074490 3:141333522-141333544 GACCCAGCAGGGGCTGTGCCTGG - Intronic
963141641 3:141950635-141950657 GACCCAGCAGGGACCTGGAGAGG - Intergenic
964751666 3:160059351-160059373 GAGGCATGAGGGGCCAGGCCAGG + Intergenic
965466128 3:169032680-169032702 GAGACAGGAGGGCCCTGGCGAGG - Intergenic
965515744 3:169619422-169619444 CACCCAGGAGGGGAAGGGCCAGG - Intronic
966854383 3:184184198-184184220 GGCCCAGGAGGGGCCTAACTGGG - Intronic
968047157 3:195630900-195630922 AGTCCAGGAGGAGCCTGGCCAGG + Intergenic
968047416 3:195631939-195631961 GGCCCAGGAGGAGCCTGGCCAGG - Intergenic
968307197 3:197657985-197658007 GGCCCAGGAGGAGCCTGGCCAGG + Intergenic
968307490 3:197659144-197659166 AGTCCAGGAGGAGCCTGGCCAGG - Intergenic
968480282 4:830206-830228 GAAGCTGGAGGGCCCTGGCCTGG - Intergenic
968513225 4:1004311-1004333 GTCCGAGAAGGGGCCTGGTCGGG - Exonic
968547299 4:1205769-1205791 GCCCCTGGTGGGGCCTGGTCAGG - Intronic
968609054 4:1548927-1548949 CACGCAGGAGCGGCCGGGCCAGG - Intergenic
968631881 4:1656101-1656123 GGCCCTGGAGAGTCCTGGCCGGG - Intronic
968688467 4:1977062-1977084 CAGCCCAGAGGGGCCTGGCCTGG + Intronic
968904656 4:3445712-3445734 GACCCCGGCGGGGCCAGCCCGGG + Intronic
968914642 4:3492137-3492159 AGCACGGGAGGGGCCTGGCCTGG + Intronic
968976688 4:3825778-3825800 AATTCAGGAGGGGCTTGGCCAGG - Intergenic
968978257 4:3833121-3833143 GACCCAAGAGGCCTCTGGCCCGG - Intergenic
969014967 4:4098004-4098026 CCTCCTGGAGGGGCCTGGCCAGG - Intergenic
969261040 4:6033941-6033963 GACTCAGGATGGGCCTGGCCTGG + Intronic
969275015 4:6128928-6128950 CACCCAGGGGGTGCCTTGCCCGG + Intronic
969431934 4:7160486-7160508 GCCCCAAGGCGGGCCTGGCCGGG - Intergenic
969475911 4:7422381-7422403 GCCACGGGAGGGGCCTGCCCAGG - Intronic
969573299 4:8022607-8022629 GACCCAGGAAGGGTCCGGACAGG - Intronic
969658097 4:8509558-8509580 GGCCCTGAAGGGGCCTGGTCAGG + Intergenic
969971706 4:11054654-11054676 GACCCAGGAGGCCCATGGCCGGG + Intergenic
970381754 4:15515289-15515311 AAGGCAGCAGGGGCCTGGCCTGG + Intronic
970488959 4:16552898-16552920 GACTCAGGATGGGCTTGGGCAGG + Intronic
973373352 4:49270946-49270968 GACAGAGGAGGAGCCGGGCCGGG - Intergenic
973387656 4:49524262-49524284 GACAGAGGAGGAGCCAGGCCGGG + Intergenic
978499469 4:109393624-109393646 AACACAGGAGGGGCCGGGCGCGG - Intergenic
978615366 4:110588157-110588179 ACCCCAGGAAGGGCCTGGGCTGG + Intergenic
979407556 4:120331808-120331830 GACCCAGGTGTGGCTTAGCCAGG - Intergenic
982702468 4:158671912-158671934 GACCCACGAGGAGACTGGGCGGG - Exonic
984767903 4:183413638-183413660 GGCCCTGCAGGGGCCTGACCTGG - Intergenic
985592682 5:773720-773742 AGCCCAAGTGGGGCCTGGCCAGG + Intergenic
985607485 5:865884-865906 AACCCAGGATGGGCCTGGTGTGG + Intronic
985622431 5:962622-962644 GACACAGCAAGAGCCTGGCCAGG + Intergenic
985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG + Intronic
985655659 5:1130301-1130323 GAGACAGGAGGTGCCTGCCCAGG - Intergenic
985677759 5:1241055-1241077 GGCTCAGGAGGGGCGCGGCCTGG + Intronic
985688678 5:1295128-1295150 GACCCGGGAGGGGTCGGGACGGG + Intergenic
985744193 5:1637225-1637247 AGGCCAGGAGGAGCCTGGCCAGG + Intergenic
985744447 5:1638233-1638255 AGTCCAGGAGGAGCCTGGCCAGG - Intergenic
985759219 5:1736377-1736399 GCCCAGGGAGGGGCCTGGTCGGG - Intergenic
985859069 5:2456092-2456114 TGCCCAGGAGCGGCCTGGCTTGG - Intergenic
985963817 5:3324669-3324691 GTCCCAGGACGGGCCTGGGCAGG - Intergenic
986004389 5:3656119-3656141 GACAGAGCAGGGGCCTGGACAGG + Intergenic
987087364 5:14483385-14483407 GAGCCAGGAGGACCCTGGCGGGG - Intronic
987291887 5:16516607-16516629 AAGCCAGGAGGAGACTGGCCAGG + Intronic
990003832 5:50922913-50922935 CACGCAGGAGCGGCCGGGCCAGG + Intergenic
990321961 5:54638836-54638858 GGCCCTGGAGGGGTGTGGCCAGG - Intergenic
990417962 5:55604948-55604970 GACCCGGGAGGTGCTGGGCCCGG + Intergenic
991486806 5:67145442-67145464 GTCCCAGGGCGGGCCTCGCCAGG + Intronic
993945314 5:94111438-94111460 AAATCAGGAGGGGGCTGGCCTGG - Intronic
995518932 5:112982056-112982078 TAGCCAGAAGGGGCCTGGCATGG - Intronic
996416533 5:123216832-123216854 GATCCATGAAGGGCCAGGCCAGG + Intergenic
996980784 5:129491290-129491312 CACTCAGGAGTGGCCCGGCCTGG - Intronic
997248202 5:132369637-132369659 GGCCCGGGCGGGGCCTGTCCTGG - Intergenic
997434137 5:133862035-133862057 GAAGCAGGAGGGGCCAGGCGCGG + Intergenic
997606579 5:135179318-135179340 GAGCCAGGAGGGGGCTGGGGTGG + Intronic
1002078778 5:176725665-176725687 GACTCCAGAGGGGCCTGCCCGGG + Intergenic
1002272245 5:178080208-178080230 TCTCCAGGAGGGGCCAGGCCTGG - Intergenic
1002478129 5:179481560-179481582 GACACAGGATGGGCCAGGCGTGG - Intergenic
1002581598 5:180212273-180212295 GGCCCAGGAAGGGCCTCTCCAGG + Intergenic
1002851953 6:1004099-1004121 GACCCAGGAGGGGCCTGGCAGGG - Intergenic
1002872445 6:1179068-1179090 GCCCCAAGAGTGGCCTGGCTTGG - Intergenic
1005892025 6:30147877-30147899 GACCCAGTGGGGGCCTGGACAGG - Exonic
1006193729 6:32224334-32224356 GCCCCAGGAGGGGCAGGACCTGG + Intergenic
1006639134 6:35480010-35480032 CACCCAGGAGGGTGCTGGGCAGG + Intronic
1006794182 6:36721665-36721687 GACCCAGCTGGGGCCTGGGGAGG - Exonic
1007390394 6:41547010-41547032 GCGCCAGGAGGAGCCGGGCCCGG + Intronic
1007390720 6:41548143-41548165 CAGCCGGGAGGGGGCTGGCCAGG - Intronic
1007748793 6:44059278-44059300 GCCCTAGGAGGGGCCTGTCTGGG - Intergenic
1007777941 6:44234228-44234250 GACCCAGCTGGGCCCTGGCCAGG + Intergenic
1013180416 6:107712566-107712588 GAGGCAGCAGGGGCCTGGCTCGG + Intronic
1013284975 6:108673369-108673391 GACAAAGGAGTGCCCTGGCCAGG - Intronic
1013602939 6:111721693-111721715 GTCACAGGAGGGGCCTGTCACGG - Intronic
1014234033 6:118935209-118935231 GAGCCAGGAGGGTCCCGGGCGGG + Intergenic
1014648684 6:124008082-124008104 GACCGAGGAGGAGTCAGGCCAGG + Intronic
1014798002 6:125748183-125748205 GACCCTGGCGGGGTTTGGCCCGG - Intronic
1015906597 6:138123443-138123465 GACACAGGAGGCCCCTGGCCTGG - Intergenic
1017110199 6:150925022-150925044 GATCCTGTAGGGGCCTGACCCGG - Intronic
1017812609 6:157994882-157994904 GTCCCAGGGGGTTCCTGGCCAGG + Intronic
1017819374 6:158038524-158038546 GAGCCTGGAGGTGCCTGGGCTGG + Intronic
1018172185 6:161152013-161152035 GACCTCGGAGGTGGCTGGCCCGG + Intronic
1018460566 6:163994781-163994803 GAATCAGGTGGGGCCTGGACAGG + Intergenic
1018632926 6:165835821-165835843 GACCCAGGAAGGGCAAAGCCAGG + Intronic
1018679701 6:166253573-166253595 GACCCCGGAGGGCCTTTGCCTGG - Intergenic
1018798249 6:167203602-167203624 GGCCGAGCAGGGGCCTGGGCAGG + Intergenic
1018814463 6:167320574-167320596 GGCCGAGCAGGGGCCTGGGCAGG - Intergenic
1019168771 6:170117001-170117023 GGCCCAGGAGAGGCCAGTCCTGG + Intergenic
1019508187 7:1403901-1403923 GAGCCGGGTGGCGCCTGGCCCGG + Intergenic
1019550879 7:1601984-1602006 GACCCAGGAGGGTCCCGTCGGGG + Intergenic
1019603779 7:1898445-1898467 GACCCGGGAGCGGCCAGGGCAGG + Intronic
1019606103 7:1910971-1910993 GGCCCTGGCGGGGCCTGGTCTGG + Intronic
1019626118 7:2016491-2016513 GAGCCAGGCGGGGCCTGGGCGGG - Intronic
1020040351 7:4996686-4996708 GGCCCAGGAGGGGCTTGGAGGGG - Intronic
1020560512 7:9726041-9726063 GTCCGGGGAGGGGGCTGGCCCGG + Intergenic
1022009097 7:26292991-26293013 CTCCCAGGAGGGGGCTGGGCTGG + Intronic
1022282712 7:28927119-28927141 AACCCAGGAGGGAACTGGCTGGG - Intergenic
1023053423 7:36272957-36272979 CTCCCAGGAGGGGCCGGGGCTGG - Intronic
1024425803 7:49225488-49225510 GTCCCAGGATGGGCCTAGCTAGG - Intergenic
1026377601 7:69767622-69767644 GAACCAATAGGGGCCAGGCCAGG + Intronic
1026564691 7:71480358-71480380 TGCCCAGGAGAGGCATGGCCAGG - Intronic
1027194476 7:76020236-76020258 GTCCCAGGAGGTCCTTGGCCAGG - Intronic
1028774075 7:94658228-94658250 GGCCCAGGAGAGGCGGGGCCTGG - Intronic
1028774104 7:94658318-94658340 GGCCCAGGAGAGGCGGGGCCTGG - Intronic
1028774119 7:94658363-94658385 GGCCCAGGAGAGGCGGGGCCTGG - Intronic
1029174670 7:98656101-98656123 AACCCAGGAGTGTCCAGGCCTGG - Intergenic
1029207758 7:98879271-98879293 GAGCCTGGGGGGCCCTGGCCGGG - Intronic
1029338052 7:99919195-99919217 GACCCAACTGGGCCCTGGCCAGG - Exonic
1029747660 7:102525410-102525432 GAGTCAGAAGAGGCCTGGCCAGG - Intergenic
1029765611 7:102624500-102624522 GAGTCAGAAGAGGCCTGGCCAGG - Intronic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1032491974 7:132330593-132330615 GACACAGTTGGGGCCTGGGCAGG - Intronic
1034426276 7:151015913-151015935 CACCCAGAAGGAGCCTGACCGGG - Exonic
1034549927 7:151813956-151813978 GACTCAGGAAGGGCAAGGCCAGG + Intronic
1034958818 7:155351663-155351685 GACCCAGGAGGGCCCTGGCTGGG - Intergenic
1035068461 7:156124411-156124433 GGCCCAGGGAGGGCATGGCCTGG - Intergenic
1035205559 7:157291910-157291932 GACCCGGGAGGGCCCCGGGCTGG + Intergenic
1035242252 7:157539816-157539838 GAGCCAGCGGGGGCCTGGCAGGG + Exonic
1035263573 7:157676335-157676357 GACAGAGGAGGGGCTGGGCCAGG - Intronic
1035299303 7:157886964-157886986 CACCCATGACGGGCCTGTCCTGG + Intronic
1035445866 7:158942769-158942791 GCCCCTCGAGGGGCCTGGGCTGG - Intronic
1035536085 8:392505-392527 GACCATGGAGGGGCCTAGCCAGG - Intergenic
1035705500 8:1671510-1671532 GCTCCAGGAGGGTCCTGTCCCGG + Intronic
1036155441 8:6338049-6338071 GACCGAGGAGTGGCCGGGCACGG + Intergenic
1036434854 8:8723604-8723626 GACCCGGGAGGGGTCGGGCGTGG + Intergenic
1036504478 8:9342786-9342808 GACACAGCAGGGGCCAGGTCGGG + Intergenic
1036588866 8:10149461-10149483 GGCCCTGGAGGGGCCTGGGCAGG - Intronic
1036964080 8:13276701-13276723 GACCCAGGAGCAGCCCGGCGCGG - Intronic
1037751002 8:21682442-21682464 GACCCTGTAAGAGCCTGGCCTGG + Intergenic
1037769081 8:21788518-21788540 TTCCCAGGAGGGGCCTGGGGAGG + Exonic
1037803877 8:22049060-22049082 GCCCCCGGAGGGGCCGGGGCCGG + Intronic
1037882624 8:22580333-22580355 CTCCCAGGAGGGGGCTGCCCAGG - Intronic
1037926188 8:22845858-22845880 GACCTGGCACGGGCCTGGCCCGG + Intronic
1038022268 8:23560618-23560640 GTCCCAGCGGGGGCCTGACCAGG + Intronic
1039475583 8:37837819-37837841 GAGCCAGGAGGGGCCCGGGGAGG + Exonic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1044283315 8:90381410-90381432 GACACAGGATGGGCCTGTCATGG + Intergenic
1044707739 8:95024934-95024956 GAACCTGCAGGGGCGTGGCCGGG + Intronic
1045503727 8:102763134-102763156 CACCCAGGAGGGGGCTTGACTGG - Intergenic
1045659533 8:104422822-104422844 CACCCAGCAGGGGCCTGCCCAGG - Intronic
1047022012 8:120785273-120785295 GGACCAGGAGGGGTATGGCCTGG + Intronic
1047496230 8:125410970-125410992 GACCCAGGCTGGCCCTGGGCCGG - Intergenic
1049148769 8:141020892-141020914 AACCCAGGAGGGGGTGGGCCTGG + Intergenic
1049191055 8:141287853-141287875 CACACAGGAGGGCCCGGGCCAGG + Intronic
1049197291 8:141322808-141322830 GACCCAGGAGGGTCAAGCCCAGG - Intergenic
1049225813 8:141449991-141450013 GATCCAGGAGGGGGCTGGTGTGG - Intergenic
1049331723 8:142058116-142058138 GCCCTTGGAGGGGCGTGGCCTGG + Intergenic
1049346861 8:142143838-142143860 GAGCCAGGAGGGGCGTGCCTCGG + Intergenic
1049414568 8:142489275-142489297 GGGCCAGGAGGAGCCTGGGCTGG + Intronic
1049526093 8:143127642-143127664 GACATAGGAGGGGCATGGCGGGG + Intergenic
1049526157 8:143127830-143127852 GACATAGGAGGGGCATGGCGGGG + Intergenic
1049573691 8:143381031-143381053 GACCCAGGACAGGCATGGCTGGG + Intronic
1049583089 8:143421532-143421554 GGCCCCGCAGGCGCCTGGCCCGG - Intronic
1049592462 8:143468834-143468856 GTCCCCAGAGGGGCCTGGCAGGG - Intronic
1049623170 8:143608220-143608242 GGCCCAGGATGGGCCAGGCGTGG - Intronic
1049643842 8:143727474-143727496 GGGCCCGGAGGAGCCTGGCCTGG - Exonic
1049685418 8:143937415-143937437 GAGCCCTGATGGGCCTGGCCTGG - Intronic
1050498398 9:6268212-6268234 GTGGCAGGAGGGGCCCGGCCAGG + Intergenic
1051620251 9:19043474-19043496 GACCTAGTAGGGGCCAGGCATGG + Intronic
1052851332 9:33380268-33380290 AGCCCTGGATGGGCCTGGCCTGG + Intergenic
1053277489 9:36794426-36794448 GAGGCAGGAGGGGCCTGAACAGG - Intergenic
1056899090 9:90582338-90582360 GATCCAGGAGGCTCCTGGGCTGG + Intergenic
1057088505 9:92234488-92234510 GACCCAGGAATGGCCAGTCCTGG + Intronic
1057231261 9:93322942-93322964 GTCCTAGGAGAGGCCTGGCAGGG - Intronic
1057725835 9:97567617-97567639 CTCCCAGGAAAGGCCTGGCCTGG - Intronic
1057861136 9:98641807-98641829 CATCCAGCAGGGCCCTGGCCAGG + Intronic
1059115789 9:111599305-111599327 CACCCGGGAGGGGGCTGGCCAGG - Intronic
1060770201 9:126326898-126326920 GGCGCGGGAGGGGCCGGGCCCGG - Exonic
1061030556 9:128079700-128079722 AACCCAGGAGGGGCCAGGCGCGG + Intronic
1061030624 9:128080073-128080095 AACTCAGGAGGGGCCGGGCATGG + Intronic
1061046548 9:128168143-128168165 GACCCATGAGGGCCAAGGCCTGG - Intronic
1061225861 9:129280710-129280732 GGCTCAGGCAGGGCCTGGCCAGG - Intergenic
1061245348 9:129398726-129398748 TCCCCAGGAGGGAGCTGGCCAGG + Intergenic
1061285467 9:129620176-129620198 GCCCCCGGAGGCGCGTGGCCAGG - Exonic
1061482242 9:130902991-130903013 GACCCAGGCCAGGCCCGGCCCGG - Exonic
1061671836 9:132193093-132193115 AACCCATCAGGGGCCTGGGCAGG + Intronic
1061678543 9:132231477-132231499 GACCCAGGGGGCCCCTGGCTGGG + Intronic
1061906587 9:133702416-133702438 GAGCCGGGAGGGCCGTGGCCTGG - Intronic
1062164988 9:135103174-135103196 GAGGCAGGAGAGGGCTGGCCGGG - Intronic
1062318989 9:135981314-135981336 GACCCCACAGGGGCCAGGCCTGG + Intergenic
1062368105 9:136221557-136221579 CACCTAGGAGGAGCCTGGCGTGG - Intronic
1062504511 9:136866148-136866170 GACTGAGGAGCGGCCGGGCCGGG - Intronic
1062624288 9:137435916-137435938 GGCCCAGGAGGGGCCCAGGCTGG - Intronic
1062631004 9:137463047-137463069 GTGACAGGAGTGGCCTGGCCTGG + Intronic
1062631113 9:137463562-137463584 GACCCAGGAGGAGCCTCCTCCGG - Intronic
1203697061 Un_GL000214v1:108949-108971 GACAGAGGAGGAGCCGGGCCGGG - Intergenic
1203746812 Un_GL000218v1:44676-44698 GCCCCTGAGGGGGCCTGGCCTGG - Intergenic
1203552148 Un_KI270743v1:172080-172102 GACAGAGGAGGAGCCGGGCCGGG + Intergenic
1203563295 Un_KI270744v1:74804-74826 GCCCCTGAGGGGGCCTGGCCTGG + Intergenic
1185753475 X:2633101-2633123 TACCCAGGAGGGGAATGGCTGGG + Intergenic
1185928314 X:4171911-4171933 GACCCAGCAGGGGCCTGAGATGG + Intergenic
1186193296 X:7086998-7087020 GCCCCAGGAGGGCCCTGAGCTGG - Intronic
1186470975 X:9822135-9822157 GACCCAGGAGCAGACAGGCCTGG + Intronic
1187173280 X:16871170-16871192 GACTCAGCAGGGGCCGGGGCTGG - Intergenic
1187429249 X:19206614-19206636 CATCCAGGCTGGGCCTGGCCTGG + Intergenic
1187468929 X:19551391-19551413 GTGCCAGGAGGACCCTGGCCAGG + Intronic
1190268948 X:48847522-48847544 GGCCTTGCAGGGGCCTGGCCAGG + Intergenic
1192178630 X:68901632-68901654 GACTCAGGAGGGGCCTAGCATGG + Intergenic
1192436847 X:71148412-71148434 TTGCCAGGAGGGGCCTGGCCCGG + Intronic
1195915016 X:109927554-109927576 CACCCAGGAAGGGCAAGGCCTGG + Intergenic
1197728879 X:129793974-129793996 GAACCTGTAGGGCCCTGGCCTGG - Exonic
1198923910 X:141764962-141764984 AACCCATGAGGGGCCGGGCGTGG - Intergenic
1199688910 X:150291251-150291273 CACCCAGGATGCCCCTGGCCAGG + Intergenic
1200134371 X:153867736-153867758 ACCCCAGGAGGGGCCAGGGCTGG + Intronic
1200245813 X:154524601-154524623 TACACAGGAGGGGCCGGGCACGG + Intergenic
1201160139 Y:11159690-11159712 GCCCCTGAGGGGGCCTGGCCTGG - Intergenic
1201730144 Y:17193662-17193684 GGCCCAGGCTGGGCCAGGCCAGG - Intergenic