ID: 985651194

View in Genome Browser
Species Human (GRCh38)
Location 5:1108550-1108572
Sequence CGTTGTGCCCAGATTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985651194_985651201 29 Left 985651194 5:1108550-1108572 CCTCCTGAAATCTGGGCACAACG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 985651201 5:1108602-1108624 GAACCTGGACGCTCTGTGTGTGG No data
985651194_985651197 3 Left 985651194 5:1108550-1108572 CCTCCTGAAATCTGGGCACAACG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 985651197 5:1108576-1108598 GCTCTCTGTCCCTACTCGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 109
985651194_985651200 14 Left 985651194 5:1108550-1108572 CCTCCTGAAATCTGGGCACAACG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 985651200 5:1108587-1108609 CTACTCGGCAGGACAGAACCTGG 0: 1
1: 0
2: 0
3: 4
4: 98
985651194_985651196 -1 Left 985651194 5:1108550-1108572 CCTCCTGAAATCTGGGCACAACG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 985651196 5:1108572-1108594 GAGAGCTCTCTGTCCCTACTCGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985651194 Original CRISPR CGTTGTGCCCAGATTTCAGG AGG (reversed) Intronic
900405912 1:2492927-2492949 GGTTGTGCTCAGCTTTCTGGGGG - Intronic
900423284 1:2564836-2564858 CCTGGAGCCCAGATGTCAGGTGG - Intronic
901171625 1:7262588-7262610 CGTTCTGCCCACCTTTTAGGTGG - Intronic
903804354 1:25994004-25994026 AGTTGTGACCAGATTTGGGGAGG + Intronic
906008919 1:42504337-42504359 TTTTGGGGCCAGATTTCAGGGGG + Intronic
911944895 1:104094657-104094679 AGTTGTGCCCACATTTCAAAAGG + Intergenic
912406047 1:109438442-109438464 CCTTATGACCAGATATCAGGAGG + Intergenic
915216587 1:154344534-154344556 CGTTGTGCCCAGGGCTCAGGTGG + Intronic
916346161 1:163793668-163793690 CATTGTTGCCAGATTTCTGGAGG + Intergenic
1065518004 10:26544119-26544141 CTTTGTGTCCAGATCTCTGGGGG - Intronic
1076080372 10:127575214-127575236 TGGTGTGACCAGATTTCAGTGGG + Intergenic
1076756880 10:132577194-132577216 CGTGGTGCCCTGAGTGCAGGTGG + Intronic
1076983578 11:219038-219060 CGTTTGGCCCATTTTTCAGGTGG - Exonic
1085185346 11:74571257-74571279 CCTTGTGTCCTGATTTCAGTAGG - Intronic
1090261032 11:125320382-125320404 CGGTGAGACCAGATGTCAGGAGG + Intronic
1102608756 12:114092165-114092187 GTTTATGGCCAGATTTCAGGGGG - Intergenic
1117748094 14:58891867-58891889 CTTTATGCCCAGATTTTTGGGGG + Intergenic
1121917671 14:97851023-97851045 CTTTGTGCCCTGACTTCAGCAGG + Intergenic
1126009439 15:44288822-44288844 CGTTTTGGCCTGATTTGAGGAGG + Exonic
1128424641 15:67528774-67528796 CGTTCTTCTCAGATTACAGGTGG - Exonic
1133265161 16:4579004-4579026 CCTTGAGCCTAGATTTCTGGAGG - Exonic
1133344133 16:5058916-5058938 TGTTGGGCCCAGATTCCAAGTGG - Intronic
1138225899 16:55294299-55294321 CTGTGTGCCCATATTCCAGGTGG - Intergenic
1138601468 16:58057387-58057409 CCTTGTCCCCAGATAACAGGAGG + Intergenic
1140432119 16:74913222-74913244 GTTTATGGCCAGATTTCAGGGGG + Intronic
1141830393 16:86507156-86507178 GGTTTTCCCCAGAATTCAGGGGG + Intergenic
1146039620 17:29438597-29438619 CCTTGGGCCCAGAGCTCAGGAGG + Intronic
1146381960 17:32337170-32337192 CATTGTGCCCAGCCTACAGGTGG - Intronic
1150154977 17:62845454-62845476 CTTTGAGTCCAGATTTCAGCTGG + Intergenic
1154383336 18:13871856-13871878 CGTGGTGCCCAGACTTCGGTGGG - Intergenic
1162580148 19:11524549-11524571 CGCTGTGCCCAGCCTTCAGTGGG - Intronic
1164281703 19:23774785-23774807 GTCTGTGCCCTGATTTCAGGAGG + Intronic
1165775735 19:38403373-38403395 CCTCATGCCCAGACTTCAGGGGG + Exonic
927062847 2:19440671-19440693 CCTTGAGCCCAGACTTCAGTGGG + Intergenic
931347419 2:61459454-61459476 AATTGTGCCCAAATTTTAGGAGG - Intronic
1173473113 20:43338764-43338786 CGAGGTGCCCAGATTGCAGACGG - Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1181311347 22:21946526-21946548 CGTGGTGACCAGATGGCAGGAGG + Intronic
1183267797 22:36840054-36840076 TGCTGTGGCCAGATTCCAGGAGG + Intergenic
1183655566 22:39182688-39182710 CAATGTGCCCATTTTTCAGGTGG - Intergenic
1184951366 22:47844699-47844721 GGTTGTGCCCAGATCTCAGAAGG - Intergenic
956511154 3:69994795-69994817 ATTTATGCCCAGATTGCAGGTGG - Intergenic
963433831 3:145242734-145242756 AGTTGTTTCCACATTTCAGGTGG + Intergenic
966313701 3:178622770-178622792 TGCTGTACTCAGATTTCAGGTGG - Intronic
966398862 3:179527339-179527361 CGTTGTGCCCAGAATACAGTTGG + Intergenic
967415639 3:189215186-189215208 CTTTGTGACCAGCTTTCCGGAGG + Intronic
969839103 4:9867693-9867715 CGGTGTCCCCAGCTCTCAGGGGG - Intronic
970165293 4:13230794-13230816 TGTTTTGCCCAGTTTTCAAGGGG - Intergenic
970336581 4:15051824-15051846 ATTTGAGCCCACATTTCAGGAGG - Intronic
976043203 4:80912807-80912829 GAGTGTGCCCACATTTCAGGAGG - Intronic
980023014 4:127731345-127731367 CGTTCTGCCCAAAATTCAAGGGG + Intronic
985558340 5:569012-569034 CGTGGTGCCCAGTGTCCAGGTGG + Intergenic
985651194 5:1108550-1108572 CGTTGTGCCCAGATTTCAGGAGG - Intronic
988861421 5:35284313-35284335 CCTTGTGCCCAGGTACCAGGTGG - Intergenic
1002424613 5:179167764-179167786 AGTTGTGCCCATTTTGCAGGTGG - Intronic
1002622881 5:180501855-180501877 CATTGTGCCCAGGTTTAGGGTGG + Intronic
1005765295 6:29005427-29005449 CTTTGGGGCCAGATTTGAGGAGG - Intergenic
1006731117 6:36236788-36236810 AGTTGTCCCCAAATTTCAGAAGG + Intergenic
1007337762 6:41166874-41166896 CTCTGTGCCCAGATGTGAGGTGG - Intergenic
1022264123 7:28736718-28736740 CGTGGTGACTGGATTTCAGGAGG + Intronic
1028595784 7:92545546-92545568 CGATGTGCCCAGATTGCAGATGG - Intergenic
1033299916 7:140176623-140176645 CGCCGCGCCCAGCTTTCAGGGGG - Intronic
1036753788 8:11459326-11459348 CATTGTGACCATCTTTCAGGTGG + Intronic
1048530157 8:135240585-135240607 TGTTCTGCGCAGACTTCAGGGGG + Intergenic
1049329112 8:142040485-142040507 CGTTCTGGGCACATTTCAGGAGG + Intergenic
1050524055 9:6530194-6530216 AGTTGTGCCCAGGGTACAGGAGG + Intergenic
1055236949 9:74133734-74133756 CACTGTGCCCAGCTCTCAGGGGG + Intergenic
1057694429 9:97313303-97313325 CGCTCTGGCCAGCTTTCAGGAGG + Exonic
1060168745 9:121443145-121443167 TGTGGTTCCCAGATTTGAGGTGG + Intergenic
1061579485 9:131528402-131528424 CGCTGTGCCCAGATCCCAGCTGG - Intronic
1062049986 9:134442311-134442333 GGCTGTGCCCAGAGTCCAGGGGG - Intergenic
1186689117 X:11955972-11955994 CTTTGAGCCCAGATTTCTGAAGG + Intergenic
1189543857 X:42021380-42021402 TGGTGTGCCCTGATTTCATGAGG - Intergenic
1190294113 X:49014491-49014513 CAAAGTGCCCAGATTGCAGGTGG + Intergenic
1194500224 X:94673060-94673082 CCTTCTGCCTAGATTTCAGAGGG - Intergenic
1198915671 X:141668800-141668822 GGTAGTGCCCAGATTACAGTTGG - Intronic