ID: 985651330

View in Genome Browser
Species Human (GRCh38)
Location 5:1109107-1109129
Sequence AGTCCCTCCTAGACAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985651319_985651330 11 Left 985651319 5:1109073-1109095 CCTCTCCCAGCCCAGGGAGCCCC 0: 1
1: 0
2: 23
3: 119
4: 1045
Right 985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG No data
985651317_985651330 15 Left 985651317 5:1109069-1109091 CCACCCTCTCCCAGCCCAGGGAG 0: 1
1: 1
2: 20
3: 228
4: 1264
Right 985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG No data
985651326_985651330 -9 Left 985651326 5:1109093-1109115 CCCAGACGAGTGGAAGTCCCTCC 0: 1
1: 0
2: 0
3: 4
4: 92
Right 985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG No data
985651322_985651330 1 Left 985651322 5:1109083-1109105 CCCAGGGAGCCCCAGACGAGTGG 0: 1
1: 0
2: 0
3: 16
4: 181
Right 985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG No data
985651321_985651330 5 Left 985651321 5:1109079-1109101 CCAGCCCAGGGAGCCCCAGACGA 0: 1
1: 0
2: 1
3: 31
4: 212
Right 985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG No data
985651325_985651330 -8 Left 985651325 5:1109092-1109114 CCCCAGACGAGTGGAAGTCCCTC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG No data
985651320_985651330 6 Left 985651320 5:1109078-1109100 CCCAGCCCAGGGAGCCCCAGACG 0: 1
1: 0
2: 3
3: 39
4: 333
Right 985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG No data
985651316_985651330 16 Left 985651316 5:1109068-1109090 CCCACCCTCTCCCAGCCCAGGGA 0: 1
1: 0
2: 5
3: 95
4: 738
Right 985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG No data
985651318_985651330 12 Left 985651318 5:1109072-1109094 CCCTCTCCCAGCCCAGGGAGCCC 0: 1
1: 0
2: 11
3: 118
4: 955
Right 985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG No data
985651327_985651330 -10 Left 985651327 5:1109094-1109116 CCAGACGAGTGGAAGTCCCTCCT 0: 1
1: 0
2: 1
3: 6
4: 56
Right 985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG No data
985651324_985651330 0 Left 985651324 5:1109084-1109106 CCAGGGAGCCCCAGACGAGTGGA 0: 1
1: 0
2: 1
3: 15
4: 169
Right 985651330 5:1109107-1109129 AGTCCCTCCTAGACAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985651330 Original CRISPR AGTCCCTCCTAGACAGTGGG TGG Intronic
No off target data available for this crispr