ID: 985651870

View in Genome Browser
Species Human (GRCh38)
Location 5:1111366-1111388
Sequence CTGTTCCGCCTCTGGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 128}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985651850_985651870 17 Left 985651850 5:1111326-1111348 CCCGGTGGCTGCCCCCTCCCCAG 0: 2
1: 0
2: 7
3: 92
4: 686
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
985651855_985651870 5 Left 985651855 5:1111338-1111360 CCCCTCCCCAGCCAGGGCGCAGT 0: 1
1: 1
2: 0
3: 42
4: 413
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
985651854_985651870 6 Left 985651854 5:1111337-1111359 CCCCCTCCCCAGCCAGGGCGCAG 0: 1
1: 0
2: 9
3: 86
4: 694
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
985651860_985651870 -2 Left 985651860 5:1111345-1111367 CCAGCCAGGGCGCAGTCCTTCCT 0: 1
1: 0
2: 0
3: 17
4: 234
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
985651859_985651870 -1 Left 985651859 5:1111344-1111366 CCCAGCCAGGGCGCAGTCCTTCC 0: 1
1: 0
2: 1
3: 13
4: 288
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
985651858_985651870 0 Left 985651858 5:1111343-1111365 CCCCAGCCAGGGCGCAGTCCTTC 0: 1
1: 0
2: 1
3: 11
4: 222
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
985651848_985651870 29 Left 985651848 5:1111314-1111336 CCTGAGCAAGGCCCCGGTGGCTG 0: 1
1: 0
2: 1
3: 22
4: 191
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
985651857_985651870 3 Left 985651857 5:1111340-1111362 CCTCCCCAGCCAGGGCGCAGTCC 0: 1
1: 0
2: 3
3: 28
4: 372
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
985651851_985651870 16 Left 985651851 5:1111327-1111349 CCGGTGGCTGCCCCCTCCCCAGC 0: 1
1: 3
2: 13
3: 111
4: 869
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
985651861_985651870 -6 Left 985651861 5:1111349-1111371 CCAGGGCGCAGTCCTTCCTGTTC 0: 1
1: 0
2: 0
3: 21
4: 153
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
985651856_985651870 4 Left 985651856 5:1111339-1111361 CCCTCCCCAGCCAGGGCGCAGTC 0: 1
1: 0
2: 0
3: 39
4: 435
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128
985651849_985651870 18 Left 985651849 5:1111325-1111347 CCCCGGTGGCTGCCCCCTCCCCA 0: 2
1: 0
2: 1
3: 53
4: 559
Right 985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG 0: 1
1: 0
2: 1
3: 10
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985651870 Original CRISPR CTGTTCCGCCTCTGGGGGGT GGG Intronic
901090477 1:6637547-6637569 CTGTTCCACCTCTGGTGAGAGGG + Intronic
901414153 1:9105434-9105456 CTGTGCCTCCTCTGGGGGCAGGG + Intronic
902414107 1:16228955-16228977 CCCTTCCGCCTCTGGTGGGTGGG - Intergenic
904873152 1:33634427-33634449 CTGCTCCTCCCCTGGGTGGTCGG + Intronic
905357033 1:37391770-37391792 CGGTGCCGCCTCTTGGTGGTTGG - Intergenic
908419857 1:63949325-63949347 CCTTTCCTTCTCTGGGGGGTGGG - Intronic
908480773 1:64536885-64536907 CTATTCTGTCTCTGTGGGGTTGG + Intronic
909984733 1:82146851-82146873 CTATGCCGCTTCTGGAGGGTTGG - Intergenic
924752331 1:246905850-246905872 CAGTTCTGTCTCTGGGGGATGGG - Intronic
1064348569 10:14555976-14555998 CTGTTTCCCCTTTTGGGGGTGGG - Intronic
1072638938 10:97196396-97196418 CTGTACCGCCGCTTGGGGGTGGG + Intronic
1073287493 10:102397515-102397537 CTGCTCGGCCTCTGGGCAGTAGG - Exonic
1075747396 10:124737238-124737260 CTCTTCCCCCTGTGGGGAGTTGG - Intronic
1075906492 10:126086180-126086202 CTGTGCAACCTCTGGGAGGTGGG - Intronic
1076600309 10:131653162-131653184 CCGTCCAGCCTCTGGGGTGTGGG - Intergenic
1076652857 10:132001919-132001941 CTGTTCCTACTCTGTGGAGTGGG + Intergenic
1077251901 11:1564469-1564491 CTGTTTCTCCGCTGGGGGTTGGG - Intronic
1077299469 11:1840391-1840413 CTGTTCCGCTTCTGCAGGGCAGG - Exonic
1078613820 11:12846247-12846269 CTGTGGAGGCTCTGGGGGGTGGG - Intronic
1080781102 11:35430890-35430912 CTTTTCCTCCTTTGGGGGATTGG - Intergenic
1083782509 11:64925615-64925637 CTGTCCGGCCTTTGGGGGGGGGG - Exonic
1084489229 11:69469316-69469338 CTGTTCTTCCTCTGGGAGGAGGG - Intergenic
1086494187 11:87385300-87385322 ATGTTCAGCCACTGGTGGGTGGG - Intergenic
1090915136 11:131156367-131156389 CTGTTCCTCCTGTGGTAGGTGGG + Intergenic
1096386903 12:51200086-51200108 CTGTGCCAGCTCTGGGAGGTAGG + Intronic
1097007483 12:55929564-55929586 CTGTTCCTCCTCAGGGTGGGGGG - Intronic
1100138014 12:91578917-91578939 CTGTACTGCCTATGGTGGGTTGG + Intergenic
1100706172 12:97202786-97202808 ATGCTCCACCTCTGGGGAGTGGG + Intergenic
1105830494 13:24160193-24160215 CTCTTCCCGCCCTGGGGGGTGGG + Intronic
1111151210 13:84255631-84255653 TTGCTCCGCCTCTCTGGGGTTGG - Intergenic
1112520361 13:100089274-100089296 CCGTGCCGCCTCTGGGCGGCTGG + Intronic
1113404389 13:110024378-110024400 CTGTTCCGCGGGTGGGGGGCAGG - Intergenic
1122270423 14:100566512-100566534 TTGTACCGCCTGTGGGGGGGAGG - Intronic
1123151700 14:106187539-106187561 CTGTGGAGCCTCTGTGGGGTTGG + Intergenic
1125044899 15:35234023-35234045 AGGTTCCTCCTGTGGGGGGTTGG - Intronic
1126365536 15:47890300-47890322 CCGCTCCTCCTCTGGGGGATGGG - Intergenic
1128160813 15:65422010-65422032 CTGGTCGGTCCCTGGGGGGTGGG + Intronic
1128736578 15:70057155-70057177 CTTTCCCAGCTCTGGGGGGTAGG - Intronic
1131054656 15:89368316-89368338 CTGCTCCGGCGCTGGGGGATAGG - Intergenic
1132496828 16:267234-267256 CTGTTCCCCCTCTGGAGGGCAGG + Intronic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1133119997 16:3600329-3600351 CTGGTCCGAGGCTGGGGGGTTGG + Intronic
1133246879 16:4455014-4455036 CTGTTCCAACTCCTGGGGGTGGG - Intronic
1136292654 16:29285238-29285260 CTGGCCCGCTTCGGGGGGGTGGG - Intergenic
1136393956 16:29982879-29982901 CTCTTCCTCCTCTGGGGCCTCGG - Exonic
1138109680 16:54313650-54313672 CTGTTCAGACTCTGGGGGTCAGG + Intergenic
1141629162 16:85277388-85277410 CTCTTCCGCCTTTCAGGGGTGGG - Intergenic
1142183224 16:88681679-88681701 CTGCTCTGCCTGTGGGGGGCTGG - Exonic
1142261481 16:89044458-89044480 CTGCTCCGCGTCTGGGGCTTGGG - Intergenic
1142598047 17:1039193-1039215 CTGACCCGCCTCTGAAGGGTGGG - Intronic
1144599827 17:16601640-16601662 AGCTTCTGCCTCTGGGGGGTGGG + Intergenic
1147478966 17:40740964-40740986 CTGTCCCCTCTCTGGAGGGTGGG - Intergenic
1147790771 17:43013255-43013277 CTGCTCAGCCACTGGGTGGTGGG - Exonic
1148259479 17:46167833-46167855 CTGTTTCTCCTCTGGGAGGTGGG + Intronic
1149008093 17:51826632-51826654 CTGTTTCTCCTCTGGGAGGCCGG + Intronic
1149399850 17:56284905-56284927 TTGTTTCTCCTCTGGGGAGTTGG - Intronic
1152502836 17:80724660-80724682 CTGCTCAGCCTGTGGTGGGTTGG + Intronic
1152912566 17:83013521-83013543 CAGTTCACCCTGTGGGGGGTCGG - Intronic
1157108185 18:44794356-44794378 CAGTTCCACCTCTTGGTGGTGGG - Intronic
1157302329 18:46488058-46488080 CTGTTCCATCCCTGGGGAGTTGG + Intronic
1157522110 18:48352488-48352510 CTGTGCCTCCTCTTGGGGATGGG - Intronic
1161064385 19:2230407-2230429 CTGTTCACCCTCCGGGGCGTGGG + Exonic
1162418819 19:10554111-10554133 CTCCTCCGCTTCTGGGGGGCTGG + Exonic
1163294589 19:16404199-16404221 ACGTTCAGCCTCTGGGGGGATGG - Intronic
1165949838 19:39468097-39468119 CTGTTCCGAGTCTCCGGGGTGGG - Intronic
1166562849 19:43744774-43744796 CTGGTCCTCCTCTGGAGTGTTGG + Exonic
925242694 2:2346341-2346363 CTGTTCCATCTTTGGGTGGTGGG + Intergenic
925987551 2:9228945-9228967 ATCTTCCACCTCTGGGGAGTTGG - Intronic
927883747 2:26706290-26706312 CAGCTCCTCCTCTGGGGGGGAGG - Intronic
932562997 2:72888645-72888667 CTGGTGCGCCTCTGGGGGCTGGG + Intronic
938459858 2:131490458-131490480 CTAGTTCGCCTCTGGGGTGTGGG + Intronic
938930391 2:136081723-136081745 CTGTTCTGCCAGTGGGAGGTGGG + Intergenic
944515714 2:200509962-200509984 CTCTTCCGCACCGGGGGGGTGGG + Exonic
944542230 2:200765315-200765337 CTCCTCCTCCTCTGGTGGGTAGG + Intergenic
945048645 2:205802885-205802907 CAGTTCTGCCTCTGGGGAGCTGG - Intergenic
947991237 2:234489225-234489247 CTGTCCATCCTCTGTGGGGTAGG + Intergenic
948566068 2:238887150-238887172 CTCTTCCTCCTCTAAGGGGTGGG - Intronic
948583278 2:239002721-239002743 CTGTTCCCTCTCTGGGGTGGGGG + Intergenic
1172778467 20:37421912-37421934 CTGTTACTCCTGTGGGTGGTGGG - Intergenic
1175606647 20:60316868-60316890 GTGTTCCGCCTCTGGGGCGTTGG + Intergenic
1175731048 20:61354176-61354198 CATTTGGGCCTCTGGGGGGTGGG - Intronic
1176040860 20:63065136-63065158 CTGTGCCGCCTCCTTGGGGTGGG - Intergenic
1176093340 20:63328618-63328640 CTGTCCAGCCTCTGGGGTGCTGG + Intronic
1177544301 21:22535917-22535939 CTGTTCTGACCCTGGGGAGTTGG - Intergenic
1178632781 21:34277247-34277269 CTGTTGCCCCTCAGGGAGGTTGG + Intergenic
1179337831 21:40474561-40474583 CTGTTCCAGCTCAGGGGGGAAGG - Intronic
1180976918 22:19853706-19853728 CTGACCCCCCTCTGGGGGGGGGG + Intronic
1181534250 22:23533526-23533548 CTCTTCCGCCGCTGGGGCCTCGG - Intergenic
1184147116 22:42618157-42618179 CTGGTTTGCCTCTGGGGGTTGGG + Exonic
950021893 3:9793160-9793182 CTGTTCGGCCTCAGGGCAGTGGG + Exonic
950808038 3:15625249-15625271 CTGTCCCGCCTGAGTGGGGTTGG - Intronic
953329894 3:42043785-42043807 CTGTGCCCCCTCTGGGGAGTTGG - Intronic
955489974 3:59472142-59472164 CTGTACCTCCTGTTGGGGGTGGG - Intergenic
959788103 3:110326061-110326083 CTGTTGCCCCTGTGTGGGGTGGG - Intergenic
969749644 4:9100436-9100458 CCATTCCTCCTCTGGGGGGACGG - Intergenic
969990261 4:11254834-11254856 CTGTCCCACCTCTGAGGGCTTGG + Intergenic
971729596 4:30360827-30360849 GTGTTCCGTCTCTGGGGTGTTGG + Intergenic
972785385 4:42321680-42321702 CTGTTCTGCCTCTGAGTGTTGGG - Intergenic
974033439 4:56796331-56796353 CTCTTCTGACTCTGGGTGGTGGG + Intergenic
977721412 4:100244172-100244194 CTCTTCCCTCTCTGGGGGTTGGG - Intergenic
979209443 4:118081635-118081657 CAGTTCATCCTCTGGGGGGCAGG - Intronic
984002239 4:174263547-174263569 CTGTTACGCATCTGGGAGTTTGG - Intronic
985651870 5:1111366-1111388 CTGTTCCGCCTCTGGGGGGTGGG + Intronic
985719309 5:1481067-1481089 CTGCAGCGCCTCTGTGGGGTGGG - Intronic
987970615 5:24939272-24939294 CAGTTCTGCCTCTGTGGGATGGG - Intergenic
996597864 5:125226118-125226140 CTGTTCACCATCTTGGGGGTGGG + Intergenic
1000211608 5:159111675-159111697 CTGTTCCTCCTCTGTGAAGTGGG - Intergenic
1005017504 6:21387957-21387979 CTGTTTGGCCTCAGAGGGGTGGG + Intergenic
1005780081 6:29181762-29181784 CTGGTCAGTCTCTGGGGTGTGGG + Intergenic
1006259066 6:32853455-32853477 CTGCTCCGGGTCTGGGCGGTGGG - Exonic
1006798502 6:36745312-36745334 CAGCTCTGCCTCTGGGTGGTGGG - Intronic
1010313728 6:74420534-74420556 CTGTTCAGCCACAGTGGGGTAGG + Intergenic
1013437702 6:110128719-110128741 CTGGTCTGCAGCTGGGGGGTTGG - Intronic
1015256431 6:131183912-131183934 CTGGCTCGCCTCTGGGGGATGGG + Intronic
1017959228 6:159207299-159207321 CTGTTCCGACTGTGAGGGGCGGG + Intronic
1018805709 6:167258141-167258163 CTGCTCCCCCTCTGAGGGTTGGG - Intergenic
1019511258 7:1418738-1418760 GTGTGCCGTCACTGGGGGGTGGG - Intergenic
1022976371 7:35560476-35560498 CTGTTCAGCTACTGGGGTGTGGG + Intergenic
1024695978 7:51857153-51857175 CTGTTCCTGCTCTGGGAGGGAGG + Intergenic
1025232731 7:57213484-57213506 CTGTTCCGCCACTGGGGATAGGG + Intergenic
1026936570 7:74259985-74260007 CTGATCAGCCTCGGAGGGGTGGG + Intergenic
1029258853 7:99287739-99287761 ATGTTTAGCCTTTGGGGGGTGGG - Intergenic
1029424692 7:100488425-100488447 CTGGGCCCCCTCTTGGGGGTGGG + Exonic
1031237777 7:119197971-119197993 CTGATCAGCCTCCGGGGGTTGGG - Intergenic
1032771878 7:135067296-135067318 CTATTCCACCTCTGGGGGCAGGG + Intronic
1035020309 7:155796917-155796939 CAGTTCAGCCTCGGGGGGCTGGG - Intergenic
1040552000 8:48444969-48444991 CAGATCAGCCTCTGGAGGGTAGG - Intergenic
1041926372 8:63241642-63241664 CTGTCCCGCCTCTGGGGGTGAGG - Intergenic
1045224593 8:100232177-100232199 CTGTTCAGCCTCTGTAGGATCGG + Intronic
1046442787 8:114281373-114281395 CTCTTCTGCCACTGGGGAGTGGG - Intergenic
1049708008 8:144051656-144051678 CTGTTCCCCCTCTGTGGGATGGG + Intronic
1054706393 9:68466921-68466943 CTCTTCTGCCTCTGGGGAGAGGG - Intronic
1056539479 9:87558961-87558983 CTGTTCCCACTCTGGGGGAGGGG + Intronic
1061195645 9:129105839-129105861 CTGTCCTCTCTCTGGGGGGTGGG + Intronic
1062251979 9:135602859-135602881 CTGTTCGCCCTCTGGTGGGCGGG - Intergenic
1062488699 9:136793695-136793717 CTCTTCCTCCTCTTGGGGCTCGG - Intronic
1189246723 X:39569008-39569030 CTGCTCTGCCTCTGTGGGGCAGG - Intergenic
1197999148 X:132413700-132413722 CTGTTGCGCCACCGGTGGGTGGG - Intronic
1199441489 X:147873460-147873482 CTGTTCCCCCTCTTGGTGGTGGG + Intergenic
1199776853 X:151019648-151019670 CAGTTTGACCTCTGGGGGGTTGG + Intergenic