ID: 985653090

View in Genome Browser
Species Human (GRCh38)
Location 5:1116051-1116073
Sequence GCAGAATTCTCGGCCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985653090_985653097 -8 Left 985653090 5:1116051-1116073 CCCACCAGGGCCGAGAATTCTGC No data
Right 985653097 5:1116066-1116088 AATTCTGCCCATGGCCAGGGTGG No data
985653090_985653108 26 Left 985653090 5:1116051-1116073 CCCACCAGGGCCGAGAATTCTGC No data
Right 985653108 5:1116100-1116122 CACATCCGCCACCACCTGTGGGG No data
985653090_985653107 25 Left 985653090 5:1116051-1116073 CCCACCAGGGCCGAGAATTCTGC No data
Right 985653107 5:1116099-1116121 CCACATCCGCCACCACCTGTGGG No data
985653090_985653105 24 Left 985653090 5:1116051-1116073 CCCACCAGGGCCGAGAATTCTGC No data
Right 985653105 5:1116098-1116120 CCCACATCCGCCACCACCTGTGG No data
985653090_985653109 27 Left 985653090 5:1116051-1116073 CCCACCAGGGCCGAGAATTCTGC No data
Right 985653109 5:1116101-1116123 ACATCCGCCACCACCTGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985653090 Original CRISPR GCAGAATTCTCGGCCCTGGT GGG (reversed) Intergenic
No off target data available for this crispr