ID: 985657017

View in Genome Browser
Species Human (GRCh38)
Location 5:1137558-1137580
Sequence CAGTGCCTGCTCGGGGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985657017_985657033 21 Left 985657017 5:1137558-1137580 CCAGACCCCCCGAGCAGGCACTG No data
Right 985657033 5:1137602-1137624 GTGGTCCCCACTCATGTCCATGG No data
985657017_985657024 -1 Left 985657017 5:1137558-1137580 CCAGACCCCCCGAGCAGGCACTG No data
Right 985657024 5:1137580-1137602 GAATGACCCCGTTCCCCTCCGGG No data
985657017_985657025 2 Left 985657017 5:1137558-1137580 CCAGACCCCCCGAGCAGGCACTG No data
Right 985657025 5:1137583-1137605 TGACCCCGTTCCCCTCCGGGTGG No data
985657017_985657023 -2 Left 985657017 5:1137558-1137580 CCAGACCCCCCGAGCAGGCACTG No data
Right 985657023 5:1137579-1137601 TGAATGACCCCGTTCCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985657017 Original CRISPR CAGTGCCTGCTCGGGGGGTC TGG (reversed) Intergenic
No off target data available for this crispr