ID: 985657890

View in Genome Browser
Species Human (GRCh38)
Location 5:1141490-1141512
Sequence GAGAGCACAGAGAGGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985657890_985657901 12 Left 985657890 5:1141490-1141512 CCTGCCTCCCTCTCTGTGCTCTC No data
Right 985657901 5:1141525-1141547 TTCTGTATCTCCTGGGATGGAGG No data
985657890_985657899 5 Left 985657890 5:1141490-1141512 CCTGCCTCCCTCTCTGTGCTCTC No data
Right 985657899 5:1141518-1141540 GCTTGTTTTCTGTATCTCCTGGG No data
985657890_985657902 20 Left 985657890 5:1141490-1141512 CCTGCCTCCCTCTCTGTGCTCTC No data
Right 985657902 5:1141533-1141555 CTCCTGGGATGGAGGCTCCCTGG No data
985657890_985657900 9 Left 985657890 5:1141490-1141512 CCTGCCTCCCTCTCTGTGCTCTC No data
Right 985657900 5:1141522-1141544 GTTTTCTGTATCTCCTGGGATGG No data
985657890_985657898 4 Left 985657890 5:1141490-1141512 CCTGCCTCCCTCTCTGTGCTCTC No data
Right 985657898 5:1141517-1141539 GGCTTGTTTTCTGTATCTCCTGG No data
985657890_985657903 21 Left 985657890 5:1141490-1141512 CCTGCCTCCCTCTCTGTGCTCTC No data
Right 985657903 5:1141534-1141556 TCCTGGGATGGAGGCTCCCTGGG No data
985657890_985657905 22 Left 985657890 5:1141490-1141512 CCTGCCTCCCTCTCTGTGCTCTC No data
Right 985657905 5:1141535-1141557 CCTGGGATGGAGGCTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985657890 Original CRISPR GAGAGCACAGAGAGGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr