ID: 985657898

View in Genome Browser
Species Human (GRCh38)
Location 5:1141517-1141539
Sequence GGCTTGTTTTCTGTATCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985657888_985657898 15 Left 985657888 5:1141479-1141501 CCACAGCTGTCCCTGCCTCCCTC No data
Right 985657898 5:1141517-1141539 GGCTTGTTTTCTGTATCTCCTGG No data
985657886_985657898 27 Left 985657886 5:1141467-1141489 CCGCCACGGGCACCACAGCTGTC No data
Right 985657898 5:1141517-1141539 GGCTTGTTTTCTGTATCTCCTGG No data
985657887_985657898 24 Left 985657887 5:1141470-1141492 CCACGGGCACCACAGCTGTCCCT No data
Right 985657898 5:1141517-1141539 GGCTTGTTTTCTGTATCTCCTGG No data
985657894_985657898 -4 Left 985657894 5:1141498-1141520 CCTCTCTGTGCTCTCCCCTGGCT No data
Right 985657898 5:1141517-1141539 GGCTTGTTTTCTGTATCTCCTGG No data
985657890_985657898 4 Left 985657890 5:1141490-1141512 CCTGCCTCCCTCTCTGTGCTCTC No data
Right 985657898 5:1141517-1141539 GGCTTGTTTTCTGTATCTCCTGG No data
985657889_985657898 5 Left 985657889 5:1141489-1141511 CCCTGCCTCCCTCTCTGTGCTCT No data
Right 985657898 5:1141517-1141539 GGCTTGTTTTCTGTATCTCCTGG No data
985657891_985657898 0 Left 985657891 5:1141494-1141516 CCTCCCTCTCTGTGCTCTCCCCT No data
Right 985657898 5:1141517-1141539 GGCTTGTTTTCTGTATCTCCTGG No data
985657893_985657898 -3 Left 985657893 5:1141497-1141519 CCCTCTCTGTGCTCTCCCCTGGC No data
Right 985657898 5:1141517-1141539 GGCTTGTTTTCTGTATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985657898 Original CRISPR GGCTTGTTTTCTGTATCTCC TGG Intergenic
No off target data available for this crispr