ID: 985657901

View in Genome Browser
Species Human (GRCh38)
Location 5:1141525-1141547
Sequence TTCTGTATCTCCTGGGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985657895_985657901 -10 Left 985657895 5:1141512-1141534 CCCCTGGCTTGTTTTCTGTATCT No data
Right 985657901 5:1141525-1141547 TTCTGTATCTCCTGGGATGGAGG No data
985657889_985657901 13 Left 985657889 5:1141489-1141511 CCCTGCCTCCCTCTCTGTGCTCT No data
Right 985657901 5:1141525-1141547 TTCTGTATCTCCTGGGATGGAGG No data
985657891_985657901 8 Left 985657891 5:1141494-1141516 CCTCCCTCTCTGTGCTCTCCCCT No data
Right 985657901 5:1141525-1141547 TTCTGTATCTCCTGGGATGGAGG No data
985657894_985657901 4 Left 985657894 5:1141498-1141520 CCTCTCTGTGCTCTCCCCTGGCT No data
Right 985657901 5:1141525-1141547 TTCTGTATCTCCTGGGATGGAGG No data
985657893_985657901 5 Left 985657893 5:1141497-1141519 CCCTCTCTGTGCTCTCCCCTGGC No data
Right 985657901 5:1141525-1141547 TTCTGTATCTCCTGGGATGGAGG No data
985657888_985657901 23 Left 985657888 5:1141479-1141501 CCACAGCTGTCCCTGCCTCCCTC No data
Right 985657901 5:1141525-1141547 TTCTGTATCTCCTGGGATGGAGG No data
985657890_985657901 12 Left 985657890 5:1141490-1141512 CCTGCCTCCCTCTCTGTGCTCTC No data
Right 985657901 5:1141525-1141547 TTCTGTATCTCCTGGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985657901 Original CRISPR TTCTGTATCTCCTGGGATGG AGG Intergenic
No off target data available for this crispr