ID: 985657903

View in Genome Browser
Species Human (GRCh38)
Location 5:1141534-1141556
Sequence TCCTGGGATGGAGGCTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985657894_985657903 13 Left 985657894 5:1141498-1141520 CCTCTCTGTGCTCTCCCCTGGCT No data
Right 985657903 5:1141534-1141556 TCCTGGGATGGAGGCTCCCTGGG No data
985657890_985657903 21 Left 985657890 5:1141490-1141512 CCTGCCTCCCTCTCTGTGCTCTC No data
Right 985657903 5:1141534-1141556 TCCTGGGATGGAGGCTCCCTGGG No data
985657895_985657903 -1 Left 985657895 5:1141512-1141534 CCCCTGGCTTGTTTTCTGTATCT No data
Right 985657903 5:1141534-1141556 TCCTGGGATGGAGGCTCCCTGGG No data
985657889_985657903 22 Left 985657889 5:1141489-1141511 CCCTGCCTCCCTCTCTGTGCTCT No data
Right 985657903 5:1141534-1141556 TCCTGGGATGGAGGCTCCCTGGG No data
985657897_985657903 -3 Left 985657897 5:1141514-1141536 CCTGGCTTGTTTTCTGTATCTCC No data
Right 985657903 5:1141534-1141556 TCCTGGGATGGAGGCTCCCTGGG No data
985657891_985657903 17 Left 985657891 5:1141494-1141516 CCTCCCTCTCTGTGCTCTCCCCT No data
Right 985657903 5:1141534-1141556 TCCTGGGATGGAGGCTCCCTGGG No data
985657893_985657903 14 Left 985657893 5:1141497-1141519 CCCTCTCTGTGCTCTCCCCTGGC No data
Right 985657903 5:1141534-1141556 TCCTGGGATGGAGGCTCCCTGGG No data
985657896_985657903 -2 Left 985657896 5:1141513-1141535 CCCTGGCTTGTTTTCTGTATCTC No data
Right 985657903 5:1141534-1141556 TCCTGGGATGGAGGCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985657903 Original CRISPR TCCTGGGATGGAGGCTCCCT GGG Intergenic
No off target data available for this crispr