ID: 985663378

View in Genome Browser
Species Human (GRCh38)
Location 5:1168765-1168787
Sequence CCTGTGATGGGGCGTGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985663378_985663390 29 Left 985663378 5:1168765-1168787 CCCAACACACGCCCCATCACAGG No data
Right 985663390 5:1168817-1168839 ACCCCCCAGCCACCGCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985663378 Original CRISPR CCTGTGATGGGGCGTGTGTT GGG (reversed) Intergenic
No off target data available for this crispr