ID: 985663569

View in Genome Browser
Species Human (GRCh38)
Location 5:1169624-1169646
Sequence CAACCACGCTGGCGCAGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985663559_985663569 19 Left 985663559 5:1169582-1169604 CCTGGAGGCAAGCCCGCCATGCT No data
Right 985663569 5:1169624-1169646 CAACCACGCTGGCGCAGGGGTGG No data
985663558_985663569 28 Left 985663558 5:1169573-1169595 CCTCTGGTTCCTGGAGGCAAGCC No data
Right 985663569 5:1169624-1169646 CAACCACGCTGGCGCAGGGGTGG No data
985663560_985663569 7 Left 985663560 5:1169594-1169616 CCCGCCATGCTCATGTATGACTC No data
Right 985663569 5:1169624-1169646 CAACCACGCTGGCGCAGGGGTGG No data
985663563_985663569 3 Left 985663563 5:1169598-1169620 CCATGCTCATGTATGACTCTGGA No data
Right 985663569 5:1169624-1169646 CAACCACGCTGGCGCAGGGGTGG No data
985663561_985663569 6 Left 985663561 5:1169595-1169617 CCGCCATGCTCATGTATGACTCT No data
Right 985663569 5:1169624-1169646 CAACCACGCTGGCGCAGGGGTGG No data
985663557_985663569 29 Left 985663557 5:1169572-1169594 CCCTCTGGTTCCTGGAGGCAAGC No data
Right 985663569 5:1169624-1169646 CAACCACGCTGGCGCAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985663569 Original CRISPR CAACCACGCTGGCGCAGGGG TGG Intergenic
No off target data available for this crispr