ID: 985665158

View in Genome Browser
Species Human (GRCh38)
Location 5:1178324-1178346
Sequence CCAGGCACGGGTGGTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985665158_985665171 30 Left 985665158 5:1178324-1178346 CCTTCAGGACCACCCGTGCCTGG No data
Right 985665171 5:1178377-1178399 CAAAAGCCACCCAGACACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985665158 Original CRISPR CCAGGCACGGGTGGTCCTGA AGG (reversed) Intergenic