ID: 985665163

View in Genome Browser
Species Human (GRCh38)
Location 5:1178333-1178355
Sequence GCCCACATCCCAGGCACGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985665163_985665172 22 Left 985665163 5:1178333-1178355 CCACCCGTGCCTGGGATGTGGGC No data
Right 985665172 5:1178378-1178400 AAAAGCCACCCAGACACCGAGGG No data
985665163_985665171 21 Left 985665163 5:1178333-1178355 CCACCCGTGCCTGGGATGTGGGC No data
Right 985665171 5:1178377-1178399 CAAAAGCCACCCAGACACCGAGG No data
985665163_985665173 23 Left 985665163 5:1178333-1178355 CCACCCGTGCCTGGGATGTGGGC No data
Right 985665173 5:1178379-1178401 AAAGCCACCCAGACACCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985665163 Original CRISPR GCCCACATCCCAGGCACGGG TGG (reversed) Intergenic