ID: 985665168

View in Genome Browser
Species Human (GRCh38)
Location 5:1178356-1178378
Sequence TGTGTGGCTGCGGCAGCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985665168_985665178 21 Left 985665168 5:1178356-1178378 CCACAAGCTGCCGCAGCCACACA No data
Right 985665178 5:1178400-1178422 GGCAAGTAGCACCAGTGCATTGG No data
985665168_985665173 0 Left 985665168 5:1178356-1178378 CCACAAGCTGCCGCAGCCACACA No data
Right 985665173 5:1178379-1178401 AAAGCCACCCAGACACCGAGGGG No data
985665168_985665172 -1 Left 985665168 5:1178356-1178378 CCACAAGCTGCCGCAGCCACACA No data
Right 985665172 5:1178378-1178400 AAAAGCCACCCAGACACCGAGGG No data
985665168_985665171 -2 Left 985665168 5:1178356-1178378 CCACAAGCTGCCGCAGCCACACA No data
Right 985665171 5:1178377-1178399 CAAAAGCCACCCAGACACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985665168 Original CRISPR TGTGTGGCTGCGGCAGCTTG TGG (reversed) Intergenic