ID: 985665172

View in Genome Browser
Species Human (GRCh38)
Location 5:1178378-1178400
Sequence AAAAGCCACCCAGACACCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985665166_985665172 13 Left 985665166 5:1178342-1178364 CCTGGGATGTGGGCCCACAAGCT No data
Right 985665172 5:1178378-1178400 AAAAGCCACCCAGACACCGAGGG No data
985665168_985665172 -1 Left 985665168 5:1178356-1178378 CCACAAGCTGCCGCAGCCACACA No data
Right 985665172 5:1178378-1178400 AAAAGCCACCCAGACACCGAGGG No data
985665165_985665172 18 Left 985665165 5:1178337-1178359 CCGTGCCTGGGATGTGGGCCCAC No data
Right 985665172 5:1178378-1178400 AAAAGCCACCCAGACACCGAGGG No data
985665164_985665172 19 Left 985665164 5:1178336-1178358 CCCGTGCCTGGGATGTGGGCCCA No data
Right 985665172 5:1178378-1178400 AAAAGCCACCCAGACACCGAGGG No data
985665163_985665172 22 Left 985665163 5:1178333-1178355 CCACCCGTGCCTGGGATGTGGGC No data
Right 985665172 5:1178378-1178400 AAAAGCCACCCAGACACCGAGGG No data
985665167_985665172 0 Left 985665167 5:1178355-1178377 CCCACAAGCTGCCGCAGCCACAC No data
Right 985665172 5:1178378-1178400 AAAAGCCACCCAGACACCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985665172 Original CRISPR AAAAGCCACCCAGACACCGA GGG Intergenic