ID: 985665173

View in Genome Browser
Species Human (GRCh38)
Location 5:1178379-1178401
Sequence AAAGCCACCCAGACACCGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985665166_985665173 14 Left 985665166 5:1178342-1178364 CCTGGGATGTGGGCCCACAAGCT No data
Right 985665173 5:1178379-1178401 AAAGCCACCCAGACACCGAGGGG No data
985665164_985665173 20 Left 985665164 5:1178336-1178358 CCCGTGCCTGGGATGTGGGCCCA No data
Right 985665173 5:1178379-1178401 AAAGCCACCCAGACACCGAGGGG No data
985665165_985665173 19 Left 985665165 5:1178337-1178359 CCGTGCCTGGGATGTGGGCCCAC No data
Right 985665173 5:1178379-1178401 AAAGCCACCCAGACACCGAGGGG No data
985665163_985665173 23 Left 985665163 5:1178333-1178355 CCACCCGTGCCTGGGATGTGGGC No data
Right 985665173 5:1178379-1178401 AAAGCCACCCAGACACCGAGGGG No data
985665168_985665173 0 Left 985665168 5:1178356-1178378 CCACAAGCTGCCGCAGCCACACA No data
Right 985665173 5:1178379-1178401 AAAGCCACCCAGACACCGAGGGG No data
985665167_985665173 1 Left 985665167 5:1178355-1178377 CCCACAAGCTGCCGCAGCCACAC No data
Right 985665173 5:1178379-1178401 AAAGCCACCCAGACACCGAGGGG No data
985665169_985665173 -10 Left 985665169 5:1178366-1178388 CCGCAGCCACACAAAAGCCACCC No data
Right 985665173 5:1178379-1178401 AAAGCCACCCAGACACCGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985665173 Original CRISPR AAAGCCACCCAGACACCGAG GGG Intergenic