ID: 985665283

View in Genome Browser
Species Human (GRCh38)
Location 5:1178911-1178933
Sequence CACCCCCACCTGCCATCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985665278_985665283 -4 Left 985665278 5:1178892-1178914 CCTAATTCAGTCCCAAGGCCACC No data
Right 985665283 5:1178911-1178933 CACCCCCACCTGCCATCCTTGGG No data
985665276_985665283 9 Left 985665276 5:1178879-1178901 CCTTGGGTGTCGGCCTAATTCAG No data
Right 985665283 5:1178911-1178933 CACCCCCACCTGCCATCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985665283 Original CRISPR CACCCCCACCTGCCATCCTT GGG Intergenic
No off target data available for this crispr