ID: 985665978

View in Genome Browser
Species Human (GRCh38)
Location 5:1181707-1181729
Sequence CCGCACCTGCGCCTGGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985665970_985665978 -5 Left 985665970 5:1181689-1181711 CCCCGGGCCAGGGAGAGGCCGCA No data
Right 985665978 5:1181707-1181729 CCGCACCTGCGCCTGGGTGGTGG No data
985665966_985665978 7 Left 985665966 5:1181677-1181699 CCTCACGCAGGTCCCCGGGCCAG No data
Right 985665978 5:1181707-1181729 CCGCACCTGCGCCTGGGTGGTGG No data
985665971_985665978 -6 Left 985665971 5:1181690-1181712 CCCGGGCCAGGGAGAGGCCGCAC No data
Right 985665978 5:1181707-1181729 CCGCACCTGCGCCTGGGTGGTGG No data
985665972_985665978 -7 Left 985665972 5:1181691-1181713 CCGGGCCAGGGAGAGGCCGCACC No data
Right 985665978 5:1181707-1181729 CCGCACCTGCGCCTGGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985665978 Original CRISPR CCGCACCTGCGCCTGGGTGG TGG Intergenic