ID: 985667420

View in Genome Browser
Species Human (GRCh38)
Location 5:1188439-1188461
Sequence TGAGTTATGCTTCCGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985667420_985667423 26 Left 985667420 5:1188439-1188461 CCTGCTGGCGGAAGCATAACTCA No data
Right 985667423 5:1188488-1188510 ACGTGTCTACCTGGAAGATAAGG No data
985667420_985667422 17 Left 985667420 5:1188439-1188461 CCTGCTGGCGGAAGCATAACTCA No data
Right 985667422 5:1188479-1188501 TTGTGATGTACGTGTCTACCTGG No data
985667420_985667424 27 Left 985667420 5:1188439-1188461 CCTGCTGGCGGAAGCATAACTCA No data
Right 985667424 5:1188489-1188511 CGTGTCTACCTGGAAGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985667420 Original CRISPR TGAGTTATGCTTCCGCCAGC AGG (reversed) Intergenic
No off target data available for this crispr