ID: 985668612

View in Genome Browser
Species Human (GRCh38)
Location 5:1195077-1195099
Sequence CAGAAAGATGTCCTCCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985668612_985668620 23 Left 985668612 5:1195077-1195099 CCTCAAGGGAGGACATCTTTCTG No data
Right 985668620 5:1195123-1195145 TCTCAAATGCAACCCGGAACAGG No data
985668612_985668619 17 Left 985668612 5:1195077-1195099 CCTCAAGGGAGGACATCTTTCTG No data
Right 985668619 5:1195117-1195139 GATGAGTCTCAAATGCAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985668612 Original CRISPR CAGAAAGATGTCCTCCCTTG AGG (reversed) Intergenic
No off target data available for this crispr