ID: 985674005 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:1220972-1220994 |
| Sequence | CCCACAGAGGGGTCTGCTTG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 304 | |||
| Summary | {0: 1, 1: 0, 2: 3, 3: 25, 4: 275} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 985673995_985674005 | 29 | Left | 985673995 | 5:1220920-1220942 | CCGTCGAGCACTGGCTGGTGGCA | 0: 1 1: 0 2: 0 3: 5 4: 122 |
||
| Right | 985674005 | 5:1220972-1220994 | CCCACAGAGGGGTCTGCTTGAGG | 0: 1 1: 0 2: 3 3: 25 4: 275 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 985674005 | Original CRISPR | CCCACAGAGGGGTCTGCTTG AGG | Intronic | ||