ID: 985674005

View in Genome Browser
Species Human (GRCh38)
Location 5:1220972-1220994
Sequence CCCACAGAGGGGTCTGCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 275}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985673995_985674005 29 Left 985673995 5:1220920-1220942 CCGTCGAGCACTGGCTGGTGGCA 0: 1
1: 0
2: 0
3: 5
4: 122
Right 985674005 5:1220972-1220994 CCCACAGAGGGGTCTGCTTGAGG 0: 1
1: 0
2: 3
3: 25
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985674005 Original CRISPR CCCACAGAGGGGTCTGCTTG AGG Intronic