ID: 985674586

View in Genome Browser
Species Human (GRCh38)
Location 5:1224477-1224499
Sequence CCTCCTGGGGGGTCTGGCTT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 318}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985674578_985674586 -10 Left 985674578 5:1224464-1224486 CCAGCTCCTGCCTCCTCCTGGGG 0: 1
1: 0
2: 8
3: 139
4: 876
Right 985674586 5:1224477-1224499 CCTCCTGGGGGGTCTGGCTTTGG 0: 1
1: 0
2: 1
3: 28
4: 318
985674573_985674586 19 Left 985674573 5:1224435-1224457 CCTCAGACGGGATGGTGGGGACG 0: 1
1: 0
2: 0
3: 12
4: 140
Right 985674586 5:1224477-1224499 CCTCCTGGGGGGTCTGGCTTTGG 0: 1
1: 0
2: 1
3: 28
4: 318
985674569_985674586 26 Left 985674569 5:1224428-1224450 CCAGTGACCTCAGACGGGATGGT 0: 1
1: 0
2: 0
3: 7
4: 71
Right 985674586 5:1224477-1224499 CCTCCTGGGGGGTCTGGCTTTGG 0: 1
1: 0
2: 1
3: 28
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985674586 Original CRISPR CCTCCTGGGGGGTCTGGCTT TGG Exonic