ID: 985677720

View in Genome Browser
Species Human (GRCh38)
Location 5:1240851-1240873
Sequence CTTTGCAGATGTAATTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 2, 1: 9, 2: 28, 3: 67, 4: 258}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985677714_985677720 13 Left 985677714 5:1240815-1240837 CCAAAACTTCAGAATGTGACCTG 0: 1
1: 2
2: 33
3: 222
4: 822
Right 985677720 5:1240851-1240873 CTTTGCAGATGTAATTAAGTAGG 0: 2
1: 9
2: 28
3: 67
4: 258
985677712_985677720 17 Left 985677712 5:1240811-1240833 CCACCCAAAACTTCAGAATGTGA 0: 1
1: 7
2: 52
3: 192
4: 587
Right 985677720 5:1240851-1240873 CTTTGCAGATGTAATTAAGTAGG 0: 2
1: 9
2: 28
3: 67
4: 258
985677719_985677720 -6 Left 985677719 5:1240834-1240856 CCTGGTTGGAAAAGGGTCTTTGC 0: 1
1: 0
2: 1
3: 9
4: 123
Right 985677720 5:1240851-1240873 CTTTGCAGATGTAATTAAGTAGG 0: 2
1: 9
2: 28
3: 67
4: 258
985677713_985677720 14 Left 985677713 5:1240814-1240836 CCCAAAACTTCAGAATGTGACCT 0: 2
1: 18
2: 172
3: 705
4: 1509
Right 985677720 5:1240851-1240873 CTTTGCAGATGTAATTAAGTAGG 0: 2
1: 9
2: 28
3: 67
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985677720 Original CRISPR CTTTGCAGATGTAATTAAGT AGG Intronic
900502113 1:3011460-3011482 CTTTGCAGATGTAACAAGGTAGG - Intergenic
900699100 1:4032948-4032970 CATTGCAGATGTCATCAAGGGGG + Intergenic
900973559 1:6004702-6004724 TTTTGCAGATGTAATTAAGGTGG - Intronic
900982463 1:6054098-6054120 CATTGCAGATATCATTAAGATGG + Intronic
902116442 1:14125404-14125426 CTTTGCAGAGGTCATTAAAAAGG + Intergenic
905856093 1:41315153-41315175 CCTTGCAGACGTAATTCATTTGG - Intergenic
909545772 1:76844841-76844863 CTTTAAAGAGGTAATTAAGTGGG - Intergenic
909877629 1:80828946-80828968 CCTTTCAGATGTGAATAAGTAGG - Intergenic
911423542 1:97677188-97677210 ATTTGCTTATGTAATTAATTTGG + Intronic
911879201 1:103212633-103212655 TTTTGTTGCTGTAATTAAGTAGG - Intergenic
915505257 1:156351458-156351480 GATTGCAGATGGAATTAAGGTGG - Intronic
917505431 1:175622989-175623011 CTTTGCAGATGTAATTAGGATGG - Intronic
918679203 1:187330236-187330258 CTTAGAATATGTAATTAATTGGG + Intergenic
920075450 1:203333092-203333114 CTTTGCAGTTATAATTAATTAGG + Intergenic
920408348 1:205737364-205737386 ATTTGCAGATGTTAAGAAGTTGG - Intronic
921544215 1:216454797-216454819 CTTTGCAGATATAATTCATTTGG - Intergenic
1063048732 10:2421360-2421382 CTTTGTAGATAAAATTAAATTGG + Intergenic
1063196688 10:3749965-3749987 CTTTACAAATGTAATTAATGGGG - Intergenic
1063617257 10:7611190-7611212 CTTTGCAAAGGTAGATAAGTTGG - Intronic
1063751798 10:8957423-8957445 GTTTGCAGATGTAATTAAGATGG - Intergenic
1064013813 10:11757820-11757842 ATTTGCAGATCTAATTGTGTGGG + Intronic
1065697262 10:28391261-28391283 CTTTGCTGCTGTAATGAAGAAGG - Intergenic
1065762838 10:28999071-28999093 GTTTGCAGATGTAATAATGAAGG + Intergenic
1066751009 10:38657115-38657137 CTTTGCCTTTGTAATTATGTGGG + Intergenic
1067138097 10:43629553-43629575 CTTTGCAGATGTAATTAGTTAGG + Intergenic
1068485668 10:57655361-57655383 CTTTGAAGATATGATTAAATGGG + Intergenic
1069373683 10:67772463-67772485 CTGTGAAGATATCATTAAGTGGG + Intergenic
1071351085 10:84745881-84745903 CTTTGCTGATGTGATTAAGTTGG - Intergenic
1071776035 10:88789147-88789169 CTTTGCATATGTGATTAAGTTGG + Intergenic
1075245462 10:120818338-120818360 CTTTGCAGATATGATAAAGAGGG + Intergenic
1078299282 11:10109123-10109145 TTTTGCATATGTATTTAATTTGG - Intronic
1078360161 11:10661782-10661804 CTTTGCAGATATGATTAAATTGG - Intronic
1078712497 11:13807924-13807946 CTTTGCAGATGTAAGTAATTAGG - Intergenic
1080289478 11:30654792-30654814 CATTCCAGATGCAATTAATTAGG - Intergenic
1081518592 11:43859562-43859584 GTTTGCAGATGTGATTAAATTGG + Intergenic
1082177615 11:49079421-49079443 CTTTGCAGATGTAACTACCTTGG - Intergenic
1084405156 11:68967830-68967852 CTTTGCAGATGTACTTAGCTAGG - Intergenic
1084905036 11:72339131-72339153 ATCTGCAGATGTAATTAAGGTGG + Intronic
1086320372 11:85640661-85640683 GTTTGCAAATGTAATCAAGTTGG + Intergenic
1086688106 11:89756453-89756475 CTTTGCAGATGTAACTACCTTGG + Intergenic
1086717745 11:90083446-90083468 CTTTGCAGATGTAACTACCTTGG - Intergenic
1086925287 11:92633458-92633480 CTTTACAAATGTCAATAAGTGGG + Intronic
1087516959 11:99176067-99176089 TTTAGCAGATGTAATTAAGTGGG - Intronic
1088680125 11:112233216-112233238 CTTTGCAGATGTGGTGAGGTGGG + Exonic
1088884802 11:113998376-113998398 CTTTGTAGAATTAATGAAGTGGG + Intergenic
1090201439 11:124860649-124860671 TTTTGCAGATGTAATTAGTTAGG + Intergenic
1091493482 12:952526-952548 CTTTGTAGATGTAATCAAGTAGG + Intronic
1092767116 12:11862708-11862730 CCTTGCAGATGTAATTAGTTAGG - Intronic
1092897894 12:13031165-13031187 CTTTGCAGATGTCCCTACGTAGG - Intergenic
1093941353 12:25058322-25058344 TTTTTCAGATGTAATGATGTTGG + Intronic
1094141578 12:27187236-27187258 TTTTGCAAATGTGGTTAAGTTGG - Intergenic
1095643684 12:44516629-44516651 CTTTGCAGATTTATTTATGGGGG + Intronic
1096933126 12:55238418-55238440 CTTTGCAGATTTAAAAAAATAGG - Intergenic
1097611997 12:61834692-61834714 CCTTGCAGATAAAAATAAGTGGG + Intronic
1098444436 12:70551713-70551735 CTCTGCAGAAGTAATAATGTTGG + Intronic
1099369025 12:81807346-81807368 ACTTGCAGATGTAATTAAAATGG - Intergenic
1099760090 12:86910177-86910199 CTTTAAAGAGGTAATTAAGATGG - Intergenic
1101851041 12:108402529-108402551 GTTTGCAGATGTAAGTAACATGG - Intergenic
1102669428 12:114604785-114604807 CTTTGTGGATGTAATGAAGCTGG + Intergenic
1103654244 12:122457612-122457634 CTTTACAGAAGTAATTGAGGAGG + Intergenic
1104222549 12:126799007-126799029 CTTTGCAGAGGTAAATAAAATGG + Intergenic
1105538849 13:21297287-21297309 GTTTGCAGATATGATTAAGATGG - Intergenic
1105846978 13:24301787-24301809 CTGTGCAGAGGTAATTTAGAAGG - Intronic
1106077408 13:26473217-26473239 CTTAGATGATGGAATTAAGTAGG - Intergenic
1107506554 13:41039986-41040008 CTTTGCTAATTTAATTTAGTAGG - Intronic
1107794033 13:44031589-44031611 CTTTGTAGATATAATTAGTTAGG - Intergenic
1108381070 13:49855052-49855074 CTTTGCAGATGTGAGTAGCTAGG + Intergenic
1108856623 13:54800466-54800488 CTTAGAAGATGTGATTAAGTCGG + Intergenic
1109099674 13:58165594-58165616 TTTTGAACTTGTAATTAAGTAGG + Intergenic
1109797414 13:67334624-67334646 ATTTTTAGATGTAATGAAGTTGG - Intergenic
1110355485 13:74562107-74562129 AATTGCAGATGTAATTAATTGGG - Intergenic
1110658678 13:78032292-78032314 CTGGGCAGATATAATTAAGCAGG + Intergenic
1111438490 13:88244650-88244672 TTTTGTAGATGTTATTAAGATGG - Intergenic
1112569413 13:100580259-100580281 CTTTGCACATGTGATTAATTAGG + Intronic
1113093156 13:106636012-106636034 CTTTGCAGATGTAAATAAGATGG - Intergenic
1115583160 14:34782695-34782717 CTTTGCAGATTTCATTAAAAAGG + Intronic
1115734546 14:36310485-36310507 CTTTGCAGATGTATGTACGGAGG - Intronic
1115762939 14:36593837-36593859 CTTTGAAGATGTAATTAGTTTGG - Intergenic
1115987575 14:39117845-39117867 TTTTGCAGATGTAAAAAAGTAGG - Intronic
1116544989 14:46154161-46154183 CTTTGTAGAAGTCACTAAGTTGG - Intergenic
1117006317 14:51424720-51424742 TCTTGCAGATGTAAAAAAGTTGG + Intergenic
1117873471 14:60224725-60224747 CTTTGCAAATGTAATTAGTTAGG + Intergenic
1118447393 14:65864078-65864100 CTTTGCAGATGTGATTTAGATGG - Intergenic
1119153464 14:72387196-72387218 TTTTGCAGATGTATATAATTAGG + Intronic
1119982858 14:79101774-79101796 CTTTGCAGATGTGATTAAAATGG + Intronic
1120086614 14:80282618-80282640 CTTTTCTGATGTAAGTAATTTGG - Intronic
1120352674 14:83383008-83383030 GTTTGCAGATGATATTAGGTTGG + Intergenic
1120684282 14:87519736-87519758 CATTGGAAATGTAATTAACTTGG - Intergenic
1120833108 14:89015466-89015488 TTTTGCAGATGTGAATAAATTGG - Intergenic
1121584792 14:95055830-95055852 CTTTGCAGATGAAAGTAATGAGG - Intergenic
1122704218 14:103609910-103609932 CATTGCAGATGTGATTAAAGTGG + Intronic
1124103440 15:26716601-26716623 CTAAGGAGATGTAAGTAAGTGGG - Intronic
1124184343 15:27510308-27510330 TTCTGCAGATGTAATGATGTTGG + Intronic
1125158674 15:36618379-36618401 CTTTGCAGATGGAACAAAATGGG + Intronic
1126309784 15:47302516-47302538 CTTTGCAGATGTGATTAAGTAGG + Intronic
1127720422 15:61693754-61693776 CATTGCAGTTGTAATTAAGAAGG + Intergenic
1128949969 15:71868507-71868529 CTTCACAGATGGAATTAAGATGG - Intronic
1130015410 15:80182268-80182290 TTCTGGAGATGTGATTAAGTTGG - Intronic
1130796049 15:87210601-87210623 CTTTGCAGACACAATTAAGGAGG + Intergenic
1130798930 15:87240712-87240734 CTTTGCAGAGGTAATCAACTTGG + Intergenic
1131206924 15:90457212-90457234 CTTTTGAGCTGTATTTAAGTGGG + Intronic
1131577024 15:93602527-93602549 CTTTGTAGATGTAATTATCCTGG - Intergenic
1132354874 15:101163724-101163746 CATTGCAGATGTAGTTAGTTAGG + Intergenic
1132898838 16:2242580-2242602 CTCTGCAGATGTAATTAAGTTGG + Intronic
1134282331 16:12828543-12828565 CTTTGCAGAAGGAATTGAGCTGG - Intergenic
1134905824 16:17978639-17978661 CTTTGCAGCTGTGATTAACAAGG + Intergenic
1135138690 16:19903619-19903641 CTTTGCAGATGTGATTAAGTTGG + Intergenic
1139077389 16:63468814-63468836 CTTTGTAGATTTATTTAAGTAGG + Intergenic
1140155037 16:72415672-72415694 CTCTGAACATGTAATTAAGGTGG + Intergenic
1140282490 16:73567246-73567268 CTTTGCAGATGTAATCAGTAAGG - Intergenic
1141315885 16:82962111-82962133 CTTTGCAGAGGTAATTAAGTTGG + Intronic
1142026227 16:87815460-87815482 CTTTGCAGATGGAATGAGCTAGG + Intergenic
1142059968 16:88022899-88022921 CTCTGCAGATGTGATTCATTAGG - Intronic
1142380965 16:89731821-89731843 CTTTGCTGAAATAATTAATTAGG + Intronic
1142817411 17:2437474-2437496 TTTTGCAGATATAATTACGCTGG - Intronic
1143972687 17:10806832-10806854 CTTTGCAGATCTAATTAGTTAGG - Intergenic
1146949988 17:36899345-36899367 CTGTGGAGATGGAATTCAGTAGG + Intergenic
1149239041 17:54627036-54627058 CTATGCTGATGTATTTAATTTGG - Intergenic
1149277925 17:55065386-55065408 CTTTAGAGATTTAATTAAATTGG - Intronic
1150476983 17:65483122-65483144 CTTTGCAGATGTAATTAGTTAGG - Intergenic
1151193920 17:72418477-72418499 CTTTGCACATGTAATTAGCTAGG - Intergenic
1151397351 17:73832427-73832449 CTTTGCAGATGTAAATAATTAGG - Intergenic
1151834779 17:76575382-76575404 CTTTGGAGATGGAATTAGTTAGG + Intronic
1152307250 17:79528560-79528582 CTTTGCAGATGTAATTAAGTTGG + Intergenic
1152342453 17:79732753-79732775 CTTTGCAGATGTGATTAGCTAGG - Intronic
1153831434 18:8927052-8927074 TTATACAGATTTAATTAAGTTGG - Intergenic
1154240115 18:12645685-12645707 CTTTGTAGATGTATTGAATTGGG - Intronic
1155432218 18:25771425-25771447 CTTTAAAGAGGTAATTGAGTGGG - Intergenic
1156438976 18:37165128-37165150 CTTTAAAGAGGTAGTTAAGTTGG - Intronic
1156871006 18:41945009-41945031 CATTGCAGATGTAATTAGTTAGG + Intergenic
1157504463 18:48216880-48216902 CACTGCAGATGTAATTAATTAGG + Intronic
1157548596 18:48565094-48565116 TTTTGCATATTTAATTAACTCGG + Intronic
1158944745 18:62438421-62438443 CTTTGCAGATGTAATTAAGGGGG + Intergenic
1159135272 18:64330108-64330130 CTTTGCACATGTAATTAATTAGG - Intergenic
1159798349 18:72868666-72868688 CTTTGCAGGAGTAATTTGGTGGG - Intergenic
1160017742 18:75157432-75157454 CTTTGTAGATGTAATCAGTTAGG + Intergenic
1160082802 18:75745385-75745407 ATTCGCAGTTGTAATAAAGTAGG + Intergenic
1160602548 18:80024886-80024908 CTTTTCAGATTTGATGAAGTCGG - Intronic
1160761839 19:789407-789429 TTCTGCAGATGTAATTAGTTAGG - Intergenic
1161649607 19:5476343-5476365 CTTTGCAGATGAAATTATCCTGG + Intergenic
1163403346 19:17107819-17107841 CTTTGCAAATGCAATTAGGTAGG - Intronic
1164059353 19:21654984-21655006 TTTTTCAGATGTAATTTGGTTGG + Intergenic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164067282 19:21728145-21728167 TTTTTCAGATGTAATTTGGTTGG - Intronic
1164458095 19:28425984-28426006 CATTGCAGATGTAACTAGTTAGG + Intergenic
1166530303 19:43538748-43538770 CATTGCAGATGTGATTGAGATGG + Intergenic
1166592505 19:44013087-44013109 CGTGGCAGATGTAGTTACGTTGG + Exonic
1167733759 19:51278642-51278664 CTTTGAAGAGGTAATGGAGTGGG + Intergenic
1167835269 19:52063196-52063218 CCTTGCAAATGTAATTAACGTGG - Intronic
1168507761 19:56950730-56950752 CTTTACAGAGGTGATCAAGTTGG + Intergenic
924983836 2:249722-249744 CCTTCCAGATGGAAGTAAGTTGG - Exonic
925139322 2:1539063-1539085 TTTTTCAGATGTAATTAGTTAGG - Intronic
925196215 2:1928268-1928290 CTGTGCAGAGGAAATGAAGTTGG + Intronic
925389966 2:3487913-3487935 CTTTGCAGATGTAATTAAATAGG - Intergenic
926765385 2:16319170-16319192 CTTTGCACAGGTAACGAAGTGGG - Intergenic
930551136 2:52836168-52836190 TGTTGCAGATGTAATTAGTTAGG - Intergenic
930917504 2:56711682-56711704 CTTTGAAGATGTGATTTTGTAGG + Intergenic
931507496 2:62946630-62946652 ATTTGTAGATGTTATTAAATTGG - Intronic
931802791 2:65774702-65774724 GTTTGCAGATGGAACTAAGGAGG - Intergenic
932481348 2:72041360-72041382 CTTTGCAAAAGTAATTAGGGAGG + Intergenic
932585298 2:73024060-73024082 TTTTACAGATGTGATAAAGTAGG + Intronic
932799057 2:74723345-74723367 CACTGCAGATGTAATTAGTTAGG - Intergenic
933079960 2:77973441-77973463 CTTTGCAGAGTCACTTAAGTTGG - Intergenic
933150526 2:78909586-78909608 TTTTGCAGATGTGATTAAACAGG + Intergenic
933844140 2:86311687-86311709 CTTTGCAAATGTAATCAAGTTGG - Intronic
934057482 2:88263816-88263838 CTTTGCAGGTGTAATTAAGGTGG - Intergenic
934582313 2:95453626-95453648 CTTTGCAGATGTAATTACCTTGG + Intergenic
934597137 2:95623088-95623110 CTTTGCAGATGTAATTACCTTGG - Intergenic
934706232 2:96483589-96483611 CTTTGCAGATGAAAATATCTAGG - Intergenic
934734586 2:96683476-96683498 CTTTGCAGATGTAATGTGTTAGG - Intergenic
934842743 2:97639912-97639934 CTTTGCAGATGTAATTACCTTGG + Intergenic
935218235 2:100991133-100991155 CTTTACAGGTGTAAGGAAGTCGG - Intronic
936558352 2:113515240-113515262 GGTTGCAGATGTAATTAGTTAGG - Intergenic
937074754 2:119094436-119094458 TTTTGTAGATGTAATATAGTTGG + Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
938779495 2:134572452-134572474 ATTTTCAGATATAATTAAATAGG - Intronic
939487014 2:142827159-142827181 GTTTCCAGTTGTAAATAAGTGGG + Intergenic
940688632 2:156885679-156885701 CATCGCAGATGTAATTAAAATGG + Intergenic
941240287 2:163027689-163027711 CATTGCAGATGTAATTAGTTTGG + Intergenic
943551513 2:189346017-189346039 CTATGCTGATGAACTTAAGTTGG - Intergenic
943785906 2:191878702-191878724 CTTTGCTGATGTGTTGAAGTTGG - Intergenic
943862936 2:192892073-192892095 CTTTGCAGATGTCATTAAGATGG - Intergenic
943956518 2:194198947-194198969 ATTTGCAGATAAAATTAAGCTGG + Intergenic
943981975 2:194564865-194564887 TTTTCCAAATGTATTTAAGTAGG + Intergenic
944931890 2:204528399-204528421 CTTTGCACATGTGATTTTGTGGG + Intergenic
945442420 2:209895951-209895973 CCTTGCAGGTGTATTTAAGGAGG - Intronic
945755241 2:213837716-213837738 CTTGGTAGATGCGATTAAGTTGG + Intronic
946950971 2:224874653-224874675 CTTTGCAAAGGTAATAAAGTTGG - Exonic
946965007 2:225028120-225028142 CTTTGCAAATATGATTAAGATGG + Intronic
947307837 2:228766623-228766645 TGTTGCAGATGTAATTAGTTAGG + Intergenic
948136007 2:235636768-235636790 CGTCGCAGATGTAATTATTTAGG + Intronic
1168957297 20:1843263-1843285 CTGTGCAGATGTAAATATATGGG + Intergenic
1170402384 20:16002371-16002393 CGATGCTGATGTAATTAAGTTGG + Intronic
1171856773 20:30352099-30352121 CTTTGGAGATGTATTTATTTAGG + Intergenic
1172333098 20:34089966-34089988 CTTTGTAGATGTATTTAAGAAGG - Intronic
1173076937 20:39828251-39828273 CATTGCAGATGTAATTAGTTAGG + Intergenic
1173833081 20:46105207-46105229 CTTTGCAGATATAGTTAATATGG + Intergenic
1174128692 20:48326880-48326902 CTTTGCAAATGTACTTAGTTAGG + Intergenic
1175010989 20:55735777-55735799 CTTTGCAGACATAATTGATTAGG - Intergenic
1176957798 21:15126374-15126396 GTCTGCAGAAGAAATTAAGTGGG - Intergenic
1177660123 21:24071976-24071998 CTTTGCCAATGTAATTAAATTGG - Intergenic
1178221335 21:30663582-30663604 CTTTGCAGATGTAATTGTTAAGG + Intergenic
1178906255 21:36639470-36639492 CTTTGCAGATGTAACTAAGATGG - Intergenic
1179015623 21:37592520-37592542 CTTTGCAAATGTAATTAGTTGGG - Intergenic
1181713187 22:24704571-24704593 CTTTGCTGATGGAATTAAGGTGG - Intergenic
1181750122 22:24983459-24983481 CCTTGTAGATGTAATTAGTTAGG - Intronic
1181992523 22:26848164-26848186 GGTTGCAGATGTTATTAAGTAGG + Intergenic
1182773732 22:32815537-32815559 CTTTGCAGATGAAAAAAATTGGG + Intronic
1184241550 22:43213528-43213550 CTTCACAGATGGAGTTAAGTGGG + Intronic
1184743985 22:46445569-46445591 CTTTCCAGATGTAATGAGTTTGG - Intronic
949148955 3:741298-741320 CTTTGCAGAAGCAAAGAAGTTGG + Intergenic
949724097 3:7023752-7023774 CTTTACAGAGGTAATTAAGATGG - Intronic
951427340 3:22563136-22563158 GGTTGCAGATGGAATTAAGATGG + Intergenic
951866556 3:27315139-27315161 CAATACAGATGTAATTAAGCAGG - Intronic
952092534 3:29906808-29906830 GTTTGTAGATGTAGATAAGTTGG - Intronic
953640790 3:44705659-44705681 CTTTGGAGAGGTAATCAGGTGGG + Intergenic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
953775528 3:45813350-45813372 CTTTGCAGATGTCATTAAGTTGG + Intergenic
954042504 3:47899460-47899482 CTTTGCAGAGGTGAGTGAGTAGG - Intronic
957034853 3:75284345-75284367 GTTTGCAGATAAAATTAAGGTGG + Intergenic
957271580 3:78037133-78037155 CTTTGAAGATGGCATTAAGTAGG - Intergenic
957348348 3:78991163-78991185 CTTTGCACATTTATTTCAGTGGG - Intronic
957459179 3:80495164-80495186 CTTTAAAGAAGTAATTAAATTGG - Intergenic
958901193 3:99888158-99888180 CTATGAAGTTGTAATTAAATAGG + Intronic
959447303 3:106456169-106456191 ATTTTCAGATGTAACTAAATTGG - Intergenic
959731262 3:109605218-109605240 GTTTGCAAATATAAATAAGTTGG + Intergenic
961434648 3:126908466-126908488 CTTTTCAGATATTCTTAAGTGGG + Intronic
962428600 3:135298285-135298307 CATTGCAGATGTAATTAGTTAGG - Intergenic
965137703 3:164794220-164794242 CTTTGCAGATTTAAATAAATGGG + Intergenic
965437871 3:168674902-168674924 CATTGCAGATGTAATTAGTTAGG - Intergenic
965478048 3:169182460-169182482 CTTTGCTGCTTTAAATAAGTTGG - Intronic
966088972 3:176107420-176107442 CTTTGCAGATGTAATTTAAGCGG + Intergenic
970743248 4:19263300-19263322 CTTTGCAAATGTTATGAACTAGG - Intergenic
972052067 4:34748990-34749012 CTTTGTAGATGTGATTAAATTGG - Intergenic
972554853 4:40171586-40171608 CTTTACAGAAGTAATCTAGTTGG + Intergenic
973122158 4:46534954-46534976 TGTTGCAGATATAATTAAGTAGG + Intergenic
974167022 4:58216557-58216579 CTTTGCAGGGGTAATTCTGTTGG - Intergenic
974427796 4:61762514-61762536 TTTTGAACATGTCATTAAGTAGG + Intronic
975102720 4:70532755-70532777 CTTTGGAGATGGAAGAAAGTTGG + Intergenic
975127098 4:70795087-70795109 CTTTCCAAATGAAATCAAGTTGG - Intronic
977580301 4:98717662-98717684 CTTTGCTGATGTAAGTAACCTGG + Intergenic
977758367 4:100700685-100700707 CCTTGTAGATATAATCAAGTTGG - Intronic
978379203 4:108109157-108109179 CTGTGCAGAACTAATTAAATTGG + Intronic
979016359 4:115439443-115439465 CTTTGCAGCTGTAATTATGTAGG + Intergenic
979447060 4:120826260-120826282 CTTTGCAGTTGTACTAAGGTGGG - Intronic
980441600 4:132854319-132854341 CTTTACAAATGTAATTCATTCGG + Intergenic
981123668 4:141081286-141081308 CTTGGCAGATGAAGTTAAGATGG - Intronic
981215483 4:142160850-142160872 CTTTGGAGATGAATTTCAGTGGG + Intronic
982841587 4:160194588-160194610 CTTTGCAAATGTTAGTAAGTAGG - Intergenic
983045732 4:162984617-162984639 ATTTACAGATGTAATTAAGATGG + Intergenic
983796531 4:171870655-171870677 CATTGTAGATGTAATTAGTTAGG + Intronic
985333836 4:188870447-188870469 CTTTGCACATGCCATTGAGTTGG + Intergenic
985677720 5:1240851-1240873 CTTTGCAGATGTAATTAAGTAGG + Intronic
985729260 5:1538127-1538149 CTTTGTAGCTGTAATTAGGAGGG - Intergenic
986331563 5:6720091-6720113 CTTTGCAGATGGAATGCAGGTGG - Intronic
987878226 5:23709198-23709220 TTTTGCAGATATAATTAAAAAGG - Intergenic
989352259 5:40499813-40499835 TGTTGCAGATGTAATTAGTTAGG + Intergenic
989535068 5:42553639-42553661 TTTTGCAGATGTAATTAAGATGG - Intronic
989734701 5:44689731-44689753 TTTTGCTGATGTTTTTAAGTGGG + Intergenic
990055000 5:51563485-51563507 ATTTGCAGGTGTAAGTATGTTGG + Intergenic
990398916 5:55416509-55416531 CATTGCATATGTAATTGACTTGG + Intronic
994068372 5:95569420-95569442 ATTTGCAGATGTAATTAGTAAGG + Intronic
994227168 5:97265918-97265940 CTTTGCAGTTGTACTTAAGATGG - Intergenic
995729058 5:115216438-115216460 CTTTTCAGAAGTCATTAAATAGG - Intronic
996237510 5:121149999-121150021 CTTTGCAAATTTGAATAAGTAGG + Intergenic
996960774 5:129246575-129246597 CTTTGCAGATGTAATCAAATTGG + Intergenic
997162737 5:131625969-131625991 TTTTGGAGATGTAATTGAGTGGG - Intronic
997399991 5:133594915-133594937 CTTTTAAAATGTCATTAAGTAGG - Intronic
997857455 5:137384865-137384887 CTTCGCAGATGTAATTAAGTTGG - Intronic
998788037 5:145733851-145733873 CTTCGCAGTTATAATGAAGTTGG + Intronic
998889702 5:146733123-146733145 CTTTACAAATGTAAATCAGTGGG + Intronic
999104462 5:149058631-149058653 CTTAGCAGATGTATGTAAGTGGG + Intronic
1000191213 5:158912696-158912718 CTTTGCAGATATAATAAATGGGG + Intronic
1000888263 5:166773366-166773388 CCATGTAGATGTAATTAAATAGG + Intergenic
1001188898 5:169607597-169607619 CTTTGCAGATATAATTAGTTAGG - Intergenic
1001962409 5:175887587-175887609 CTTAGCACTTGTAATTAATTGGG + Intergenic
1003034346 6:2630062-2630084 CTTTGCAGACATAATTAAGTTGG + Intronic
1004370350 6:15047098-15047120 CTTTGCAGCTACAATTAAGACGG + Intergenic
1004563133 6:16770449-16770471 TTTTGCAGATGTAATTAGTTAGG + Intergenic
1005008431 6:21313038-21313060 CATTGCAAATGTAATCAGGTAGG + Intergenic
1007388091 6:41532791-41532813 CATTGCAGATGTAATCAGTTAGG + Intergenic
1007981245 6:46161137-46161159 CTTTGCAGGTGTAAGTATTTTGG + Exonic
1008230624 6:48982274-48982296 CTTTGCCGATGTCATTAGTTGGG - Intergenic
1008618154 6:53245907-53245929 CTTTGCAGATGTGATGAGATGGG - Intergenic
1008840151 6:55893168-55893190 ATTTGCAGATGTTATTAATTAGG - Intergenic
1009518590 6:64653036-64653058 CTTTGCCGATGAAAGTAAGATGG + Intronic
1011613030 6:89171868-89171890 CTCTGCACATGTCATTAACTGGG + Intergenic
1012032208 6:94086008-94086030 CTTTGCCTATGAAATTAAATTGG + Intergenic
1012088487 6:94859977-94859999 CTTTGCCGACGTAATTAGCTAGG - Intergenic
1012698620 6:102422552-102422574 CTTTGCAGAAGTTATTTAATTGG - Intergenic
1012966712 6:105682593-105682615 CTTTGTAGATGTGAAAAAGTGGG - Intergenic
1013480075 6:110545409-110545431 CTTTGCAGAGGTAATTCATAAGG - Intergenic
1013540679 6:111105107-111105129 CATTTGTGATGTAATTAAGTTGG + Intronic
1013587508 6:111592647-111592669 CTTTGAGGATGGAATTAAGCTGG + Intronic
1014068963 6:117159351-117159373 CTTTGCAGATGTAATTAATTAGG - Intergenic
1015286600 6:131492382-131492404 CATTGCAGTTGTAATTAGTTAGG + Intergenic
1015402494 6:132801901-132801923 CTGTGCAGATGTGACTAAATTGG - Intergenic
1016327106 6:142915261-142915283 CCTTGCAGATGTAATTAGTTAGG + Intronic
1017019754 6:150130699-150130721 CATTGCAGATGTAATCAGTTAGG - Intergenic
1017410033 6:154158167-154158189 GTTTGCAGATATAATTCAGGTGG + Exonic
1017916816 6:158837461-158837483 CATTGCAAATGTAATTAGTTTGG - Intergenic
1018830555 6:167439641-167439663 CTTTGCGGGTGTAATTAGTTAGG + Intergenic
1019931094 7:4223666-4223688 AGTTGCAGATGTAATTAGTTAGG - Intronic
1020577800 7:9956463-9956485 CTTTGCAAATATGATTAACTTGG + Intergenic
1020658654 7:10956590-10956612 CTTTGCATACGTAATTAATCCGG + Intergenic
1020988859 7:15170639-15170661 CTCTGCTAATGTAATTAAATTGG - Intergenic
1022842363 7:34176660-34176682 CTTTGCAGATGGAATGGAGGTGG + Intergenic
1022851097 7:34262963-34262985 CTTTGCAGGTTTAATTGAATAGG + Intergenic
1023133006 7:37022077-37022099 CTTTGCAGATGGTATGAGGTAGG - Intronic
1023859643 7:44210493-44210515 CTTGGCAGATGTAACTAGTTAGG - Intronic
1024479726 7:49851288-49851310 TTTTGCAAATGTAATTAAGAAGG - Intronic
1027440926 7:78218271-78218293 CTTTGCAGATGTACATACGAGGG + Intronic
1027465364 7:78508185-78508207 CATTGCAGATATAATTAGTTAGG - Intronic
1027771832 7:82416718-82416740 CTTTGCAGATGTAACTAGTTAGG - Intronic
1028689413 7:93634935-93634957 ATTTGCAGATGAGATTAAGGTGG + Intronic
1030460621 7:109830364-109830386 CTTTGGAGATATTATTAAATAGG + Intergenic
1031527964 7:122844231-122844253 CAATCCAGATGTAACTAAGTTGG + Intronic
1032362210 7:131266462-131266484 CTTTGTAAATGTAATTTATTTGG + Intronic
1033016102 7:137673149-137673171 TGTTGCAGATGTAATTAATTAGG - Intronic
1033204386 7:139405106-139405128 CTTTGCTGATGTGTTTAAGTGGG + Intronic
1037320703 8:17640190-17640212 CTTTTTTGATTTAATTAAGTTGG + Intronic
1037363344 8:18096890-18096912 TTTTCCAGATGTCTTTAAGTTGG + Intergenic
1038464354 8:27747194-27747216 CTTTGCAGATGTCATTAGTTAGG + Intronic
1038666425 8:29541592-29541614 CTTTGCTGAAGTAATTAAGATGG + Intergenic
1041223439 8:55674480-55674502 CTTTGCAGATGTATTTGAGTAGG + Intergenic
1042775765 8:72429262-72429284 CATTGCAGATGTAATTAGATAGG + Intergenic
1043245178 8:77990378-77990400 TGTTGCAGATGTAATTAGGTAGG + Intergenic
1043624222 8:82234626-82234648 CTTTTAACATGTAATTAAGTAGG - Intergenic
1043942315 8:86209848-86209870 CTTTGCAGATGTAAGAAGTTCGG + Intergenic
1044997965 8:97855254-97855276 CTTTGCAGAAGTAAATATGGAGG - Intergenic
1045063998 8:98429272-98429294 CTTTGGAGATGGAATGAAGGAGG + Exonic
1045540819 8:103083009-103083031 CTTTTCAGATTTTATTAATTTGG - Intergenic
1046807281 8:118493567-118493589 CTTTGCAAATGTGATCAAGGTGG + Intronic
1047091720 8:121582569-121582591 CCTTGAAGATCTAATTAAGATGG - Intergenic
1047715663 8:127592752-127592774 CTTGGAAGATGTCCTTAAGTAGG - Intergenic
1047981849 8:130191663-130191685 CTTTACAGATGTGGTTAAGAGGG - Intronic
1048003056 8:130395367-130395389 CTTTGCAGATATAATTAAGGTGG + Intronic
1050512378 9:6409632-6409654 GTTTCCAGATGTAATTCATTTGG + Intergenic
1050647084 9:7731858-7731880 ATTTGCTGATATAATTAATTAGG + Intergenic
1051519649 9:17971655-17971677 CTTTGCAAATTTAACTAAATGGG + Intergenic
1051759180 9:20441998-20442020 CTTTCCAAATGTAAGTATGTGGG + Intronic
1051972117 9:22901520-22901542 CTTTTCAGTTGTGATTAAATAGG + Intergenic
1055665586 9:78549703-78549725 GTTTGCAGACGGAATTAAGGAGG + Intergenic
1055676244 9:78664618-78664640 CTTTGCAGGTTGAATTAGGTAGG + Intergenic
1055707495 9:79022341-79022363 CTTTGCAATTGTGATTAATTAGG - Intergenic
1056502298 9:87221886-87221908 CTTTGAAGATGTAATTAATTAGG - Intergenic
1056724175 9:89097978-89098000 CTTTGATGATTTAATTAAGATGG - Intronic
1058154065 9:101492511-101492533 CTTTGCACATCTAATAAATTTGG + Intronic
1058855482 9:109057855-109057877 CTTTGCAAATGTATTTAGGAGGG - Intronic
1059819444 9:117956053-117956075 CTTCACATATGTAATTCAGTGGG + Intergenic
1060741577 9:126101805-126101827 CTTTGCAGATGGACTTTATTTGG + Intergenic
1185527957 X:794187-794209 TTCTGCAGTTGGAATTAAGTGGG + Intergenic
1186794123 X:13027879-13027901 CTCAGCAGAATTAATTAAGTAGG - Intergenic
1186883264 X:13887510-13887532 CCTTGAAGTTATAATTAAGTGGG + Intronic
1187491283 X:19753764-19753786 CTTTACAGTTCTAATGAAGTTGG - Intronic
1187575980 X:20555811-20555833 CTTTGAACATGGTATTAAGTAGG - Intergenic
1189842525 X:45095798-45095820 CTTTGCAGATGTACAACAGTTGG - Intronic
1190047131 X:47121421-47121443 TGTTGCAGATGTAATTAGTTAGG - Intergenic
1194044008 X:88979317-88979339 ATTTGCACATGTAATTATGTAGG + Intergenic
1194862583 X:99020587-99020609 CTTTGCAGTTGTATATGAGTGGG - Intergenic
1198558127 X:137818092-137818114 CTTTGCAGATGTTATTAAATTGG + Intergenic
1198948121 X:142038374-142038396 TTTTGCAGATGAAATTAATAAGG - Intergenic
1201951782 Y:19573197-19573219 ATTTGCAGATATCATAAAGTAGG + Intergenic
1202106903 Y:21380422-21380444 CTTTGCATATTTAATGAACTTGG - Intergenic