ID: 985678194

View in Genome Browser
Species Human (GRCh38)
Location 5:1243064-1243086
Sequence CTGCTGGGTGCAGCGTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985678194_985678206 18 Left 985678194 5:1243064-1243086 CCAGCAGACGCTGCACCCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 271
Right 985678206 5:1243105-1243127 CCCGAGAGAGTGGGCATTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 161
985678194_985678204 9 Left 985678194 5:1243064-1243086 CCAGCAGACGCTGCACCCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 271
Right 985678204 5:1243096-1243118 TTGGGCTGACCCGAGAGAGTGGG 0: 1
1: 0
2: 0
3: 8
4: 58
985678194_985678199 -10 Left 985678194 5:1243064-1243086 CCAGCAGACGCTGCACCCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 271
Right 985678199 5:1243077-1243099 CACCCAGCAGTCTTGGGGGTTGG 0: 1
1: 1
2: 3
3: 32
4: 280
985678194_985678203 8 Left 985678194 5:1243064-1243086 CCAGCAGACGCTGCACCCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 271
Right 985678203 5:1243095-1243117 GTTGGGCTGACCCGAGAGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 110
985678194_985678200 -9 Left 985678194 5:1243064-1243086 CCAGCAGACGCTGCACCCAGCAG 0: 1
1: 0
2: 1
3: 19
4: 271
Right 985678200 5:1243078-1243100 ACCCAGCAGTCTTGGGGGTTGGG 0: 1
1: 0
2: 1
3: 22
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985678194 Original CRISPR CTGCTGGGTGCAGCGTCTGC TGG (reversed) Intronic
900100953 1:961819-961841 CGGCTGGGAGCAGAGTCTACGGG - Exonic
900399371 1:2466750-2466772 ATGCTGGGAGCAGCGCGTGCAGG + Intronic
900558949 1:3294237-3294259 CTCTTGGGGGCAGAGTCTGCTGG + Intronic
900596023 1:3480548-3480570 CCGCAGGATGGAGCGTCTGCGGG + Exonic
901082743 1:6592797-6592819 GTTCTGGGTGCAGCCTCTGGAGG + Exonic
901596471 1:10389409-10389431 GTGCTGGGTGCTGCCTCTGCTGG - Intergenic
903066455 1:20702390-20702412 CTGCTGGGTGCGGGGGCCGCGGG + Intronic
904211500 1:28889044-28889066 CTGCTGTGTGCAGAGCCTACTGG - Intronic
905013588 1:34762579-34762601 CTGCTGGGCACAGGGTCTCCTGG - Exonic
905346161 1:37312549-37312571 CTGCTGGCTGCAGGGTCAACAGG + Intergenic
905772048 1:40644739-40644761 GTGCTGGGTGCAGAGCATGCTGG - Intronic
905829460 1:41053559-41053581 CTGTTGCATGCAGCGTCAGCTGG - Intronic
906141548 1:43536718-43536740 ATGCTGGGAGCAGCAGCTGCTGG + Intronic
906149305 1:43578275-43578297 GTGCTGGGAGCAGAGGCTGCTGG + Intronic
906528241 1:46508835-46508857 CTGCTGGCTCCAGGGACTGCAGG - Intronic
910493769 1:87802478-87802500 CTGCTGAGTGCCCAGTCTGCTGG - Intergenic
911649948 1:100376561-100376583 CTGCTGGGTCCACCATCTACAGG - Intronic
912387625 1:109280062-109280084 CTGCTGGAGTCAGGGTCTGCTGG + Exonic
913338655 1:117734244-117734266 CCCCTGGGTGCTGGGTCTGCCGG - Intergenic
913531803 1:119738846-119738868 CTGCTGGGTGTATCTGCTGCAGG + Intronic
914241150 1:145853982-145854004 CTGCTGGGTGGAGCGTCTTTGGG + Intronic
915269743 1:154745488-154745510 CAGCTGGATGCAACCTCTGCAGG + Intronic
915324258 1:155072572-155072594 CGGCTGGGTGGAGGGTCTCCAGG + Intergenic
919420377 1:197363580-197363602 GTGCTGGGTGCAGGGTTTGGGGG + Intronic
919856491 1:201709686-201709708 CTGCAGGGTGTAGCCTCTGCAGG + Intronic
922044182 1:221927832-221927854 CTGCACTGTGCAGCGGCTGCTGG - Intergenic
1066964297 10:42247352-42247374 CTGCTGTGTGCTGCTGCTGCTGG - Intergenic
1067066233 10:43105675-43105697 CTGCTGGGTGGGCCGGCTGCAGG - Intronic
1070392959 10:75987402-75987424 TTGGTGGGGGCAGCTTCTGCTGG - Intronic
1070788125 10:79174144-79174166 CTGGTGGGTGCAACCTGTGCTGG - Intronic
1071572741 10:86706852-86706874 CTGCTTGGTGCAGAGTGTGAAGG + Intronic
1074766482 10:116703776-116703798 CTGCAGGGTGCTGGGTGTGCGGG + Intronic
1076728056 10:132422397-132422419 CTGCTGGGTGCAGACGCAGCTGG + Intergenic
1076879405 10:133232436-133232458 CTGCTGGGTGCTGGGCCAGCGGG - Intergenic
1077097006 11:803315-803337 GTGCTGGGGGCAGCGTCTGCAGG + Exonic
1077357202 11:2123842-2123864 ATGCTGGGTGAGGGGTCTGCAGG + Intergenic
1078367725 11:10720549-10720571 CTGCTGGGCGCTGCTTCTGTGGG + Intergenic
1078544688 11:12238789-12238811 CAGCTGGGTGAAGGGTATGCAGG + Intronic
1083950978 11:65955993-65956015 CTCCTGGGTGCAGCGGGCGCAGG + Intronic
1084163155 11:67361936-67361958 ATGCAGGGGGCAGGGTCTGCAGG + Intronic
1085176617 11:74493610-74493632 CCGCTGGCTGCGGCGGCTGCAGG - Exonic
1087013900 11:93538203-93538225 CTGACGGGTGCAGTCTCTGCGGG - Intronic
1087196193 11:95306314-95306336 CTGCTGGGTGCAGGGCTTCCAGG + Intergenic
1088598197 11:111455334-111455356 CTGGTGGCTGTAGCGCCTGCAGG + Intronic
1089242916 11:117097787-117097809 CTGCTGGTTCCAGAGTCTTCTGG + Intronic
1089539234 11:119180019-119180041 CTGATGGGGGCAGCACCTGCCGG - Exonic
1090965883 11:131597411-131597433 TTGCTGAGTGCAGCCTCTGCAGG - Intronic
1091301843 11:134512936-134512958 CTCCTGTGTTCAGTGTCTGCTGG - Intergenic
1092783649 12:12009141-12009163 CTGCAGGGTGAAGAATCTGCAGG + Intergenic
1094842202 12:34346866-34346888 CTGCTGGGTCCAGCCGCTCCGGG + Intergenic
1095719564 12:45385968-45385990 CTGCCTGCTGCAGGGTCTGCAGG + Intronic
1095958644 12:47820050-47820072 CCGCGCGGTGCAGTGTCTGCCGG - Intronic
1096744097 12:53714301-53714323 TTCTTGGGTGCAGCTTCTGCAGG - Intronic
1096792755 12:54055089-54055111 GTGCTGGGCGCAGCGCCGGCCGG - Exonic
1097179897 12:57165859-57165881 CTCCTGGATGCAGCGGCTGTTGG - Exonic
1097909036 12:64949340-64949362 CTGGTGGTTGCTGCTTCTGCAGG + Intergenic
1099031764 12:77535020-77535042 CTGGTGATTGCAGCTTCTGCAGG + Intergenic
1103931707 12:124454059-124454081 CTGCATGGTGCACCCTCTGCAGG - Intronic
1103935596 12:124474889-124474911 CCTCTGGGTGCAGCTGCTGCGGG - Intronic
1104153446 12:126107317-126107339 CTTCTGGGTGAAGCTGCTGCTGG + Intergenic
1108036641 13:46297033-46297055 CTGATGGGGGCAGCGTGTGGAGG - Intergenic
1108356568 13:49633759-49633781 CAGCTGGGTTCAGCTTTTGCAGG + Exonic
1113099518 13:106702197-106702219 CTGGTGGGTGCAGCTTCTTAGGG - Intergenic
1113456927 13:110455997-110456019 CTGCTGGGGGCAGGCTCTGCAGG - Intronic
1113463404 13:110497168-110497190 CTCCTGGGTGGAGCTTCTGCTGG - Intronic
1113617843 13:111693791-111693813 CTGCAGGCTGCAGCCTCGGCCGG + Intergenic
1113623376 13:111779052-111779074 CTGCAGGCTGCAGCCTCGGCCGG + Intergenic
1113742133 13:112718545-112718567 TAGCTGGGTGCTGCCTCTGCGGG - Intronic
1113926339 13:113943871-113943893 CAGCCGGGTGCAGGGACTGCGGG - Intergenic
1116835661 14:49767603-49767625 CTGCCGGGCGCCGCCTCTGCGGG - Exonic
1118710076 14:68511616-68511638 CTGCTGAGAGCAAGGTCTGCTGG - Intronic
1122577499 14:102751362-102751384 GTGCAGGGTGCAGCGCCCGCCGG + Intergenic
1123069884 14:105637485-105637507 CTGCAGGGGGCAGCAGCTGCAGG + Intergenic
1123467233 15:20526320-20526342 CTGCTCGGTGCAGACTTTGCAGG - Intergenic
1123650882 15:22474722-22474744 CTGCTCGGTGCAGACTTTGCAGG + Intergenic
1123741290 15:23283564-23283586 CTGCTCGGTGCAGACTTTGCAGG + Intergenic
1123745707 15:23318994-23319016 CTGCTCGGTGCAGACTTTGCAGG - Intergenic
1124277979 15:28342311-28342333 CTGCTCGGTGCAGACTTTGCAGG - Intergenic
1124304724 15:28569297-28569319 CTGCTCGGTGCAGACTTTGCAGG + Intergenic
1124994961 15:34714645-34714667 CTGCAGGGGGCAGAGGCTGCAGG - Intergenic
1125828474 15:42694745-42694767 CTGCTGGGAGCAGGCTCTGTTGG + Intronic
1126348180 15:47718145-47718167 CTGCCGGGCACAGCGTCTCCAGG + Intronic
1126906967 15:53378296-53378318 ATTCTGGGTGCAGTGTCAGCAGG - Intergenic
1127309947 15:57743704-57743726 TTGCTGGGTGCAGAGTCTTGGGG + Intronic
1127488178 15:59438213-59438235 CGGCTGGGTGCGGCGGCCGCTGG - Exonic
1129006234 15:72375920-72375942 CTGCTGGCGGCAGCGTTCGCAGG - Exonic
1129311802 15:74718057-74718079 CTGCTTTGTGCAGCGGCGGCCGG - Intergenic
1129364944 15:75048470-75048492 CTGCTGGCTGCAGGGTCTGGAGG + Intronic
1129741247 15:77990712-77990734 CTGCTGGGAGCAGCTGCAGCTGG - Intronic
1129937994 15:79466684-79466706 CTGAGGGGTGCAGGGCCTGCGGG + Intronic
1130394240 15:83488277-83488299 CACCTGGGAGCAGCGCCTGCAGG - Intronic
1130988338 15:88859254-88859276 CTGCAGGGCGCTGGGTCTGCTGG - Exonic
1132358613 15:101193119-101193141 TTGCTGTGTGCAGTGGCTGCGGG - Intronic
1132462326 16:61697-61719 CTGCGGGGTGGAGCGTCAGCGGG + Intronic
1132677093 16:1125310-1125332 GTGCTGGGTGCAGCCCCTCCTGG - Intergenic
1132913648 16:2329655-2329677 CTGCTGTGTGGAGCCTCTTCTGG - Exonic
1134435506 16:14252945-14252967 CTGCTGGGGGCAGAGGTTGCTGG - Intronic
1134666937 16:16025517-16025539 CTGCTGGGTGCAGGGGTTGTGGG + Intronic
1134834451 16:17349111-17349133 CTGCTGTGCTCACCGTCTGCAGG + Intronic
1135993556 16:27231933-27231955 CTGGTGAGTGCAGGATCTGCTGG - Intronic
1136729977 16:32401349-32401371 CTGCTGTGTGCTGCTGCTGCTGG - Intergenic
1139303335 16:65963276-65963298 CAGCCAGGTGCAGAGTCTGCGGG - Intergenic
1141464458 16:84196809-84196831 CTGCAGGGGGCAGGGACTGCAGG - Intronic
1141978326 16:87533252-87533274 CTGCTGGGTGGTTCTTCTGCTGG + Intergenic
1142133798 16:88442615-88442637 CGCCTGGGGGCTGCGTCTGCTGG - Intergenic
1142413990 16:89931460-89931482 CGTCTGGGAGCAGTGTCTGCAGG - Intronic
1202996417 16_KI270728v1_random:115956-115978 CTGCTGTGTGCTGCTGCTGCTGG + Intergenic
1203023104 16_KI270728v1_random:428298-428320 CTGCTGTGTGCTGCTGCTGCTGG + Intergenic
1143039363 17:4022109-4022131 CTGCAGGTTCCAGCCTCTGCTGG + Intronic
1143360370 17:6364457-6364479 CTACTGGGTGCTCCTTCTGCTGG - Intergenic
1143411912 17:6714055-6714077 CTGCGGGGTGCAGCGTCCACTGG - Intergenic
1143822560 17:9576640-9576662 CTAGTGGCTGCAGCGTCTTCTGG - Exonic
1144803291 17:17946652-17946674 CTCATGGGTGCAGAGGCTGCAGG + Intronic
1145259057 17:21343918-21343940 CTGCTGTGTGCAGTCTCTGATGG + Intergenic
1145317561 17:21744085-21744107 CTGCTGTGTGCAGTCTCTGATGG - Intergenic
1146852560 17:36235766-36235788 ATGCTGGGTGCAGTGAATGCTGG - Intronic
1146868473 17:36359638-36359660 ATGCTGGGTGCAGTGAATGCTGG - Intronic
1146935217 17:36808739-36808761 CAGCTGGGAGCTGCGTCTGGAGG + Intergenic
1147071345 17:37960262-37960284 ATGCTGGGTGCAGTGAATGCTGG - Intergenic
1147082872 17:38039788-38039810 ATGCTGGGTGCAGTGAATGCTGG - Intronic
1147098815 17:38163759-38163781 ATGCTGGGTGCAGTGAATGCTGG - Intergenic
1147214283 17:38890413-38890435 CTGCTTGGGGTAGTGTCTGCAGG - Exonic
1148818884 17:50348888-50348910 CTGCTGGGGGCAGCCTGTGAGGG + Intronic
1149363132 17:55914484-55914506 CTGCTGGCTGAAGTGTCTGCGGG + Intergenic
1150080348 17:62232801-62232823 ATGCTGGGTGCAGTGAATGCTGG - Intergenic
1151279997 17:73066331-73066353 CAGCTGGGTGCTTCTTCTGCTGG - Intronic
1151799557 17:76369970-76369992 CCGGTGGTTGCAGCGTCAGCGGG - Intronic
1152469303 17:80482083-80482105 CTCCTGGCTGCAGCTGCTGCAGG - Intergenic
1152641133 17:81449709-81449731 CTGCTGGGTCCAGGATCCGCAGG - Intronic
1152755583 17:82085687-82085709 GCGCTGGGGGCAGGGTCTGCGGG + Exonic
1154340793 18:13500478-13500500 CTCCTGGGAGCAGCGCCTGTGGG + Intronic
1156863625 18:41865779-41865801 GTGCTGCGTGCAGCGCTTGCAGG + Intergenic
1160018769 18:75164540-75164562 CTCCTGAGAGCAGGGTCTGCAGG + Intergenic
1160334548 18:78027075-78027097 CTGCAGGGTGAGGCATCTGCAGG - Intergenic
1161591070 19:5129275-5129297 CTCCTGGCTGCAGGGTCTGTTGG + Intronic
1161591568 19:5131477-5131499 CTGCTGGCTGCACCGTCCTCTGG - Exonic
1162547551 19:11339595-11339617 CTGCTGGCTTCTGCGGCTGCGGG - Exonic
1163084943 19:14972829-14972851 GGGCTGGCTGCAGCGGCTGCAGG - Exonic
1163291346 19:16381344-16381366 CAGCTGAGGGCAGCGTCTGGTGG - Intronic
1163311705 19:16518926-16518948 CTGGTGGCTGCAGCGCCTCCTGG + Exonic
1164609487 19:29622408-29622430 CTGCTGGGCTCAGCCTCTCCAGG - Intergenic
1165560218 19:36672599-36672621 CTGCTGAGTGCCCAGTCTGCTGG + Intergenic
1165948484 19:39459223-39459245 CTCCTGGGAGCAGCTGCTGCTGG - Exonic
1167132903 19:47599265-47599287 CTGCGGGGTGCAGGGGCTGCGGG + Intergenic
1167786754 19:51643815-51643837 CTGCCGGGTTCAGCATCCGCTGG - Exonic
925090179 2:1148849-1148871 CTGCTGGGCCCACCCTCTGCAGG + Intronic
925376192 2:3387981-3388003 CTACTGGGTGCCGCGTCCTCGGG - Exonic
925386279 2:3463942-3463964 CTGGTGAGTGCAGCCTCTGTTGG + Intronic
926245027 2:11116766-11116788 TTGCTGAGGGCAGTGTCTGCAGG - Intergenic
928432776 2:31234405-31234427 CTGCTGGATGCAGCAGCGGCTGG + Exonic
929531928 2:42758126-42758148 CTCCTGGGTGCAGAGATTGCTGG + Intergenic
929594496 2:43167903-43167925 CTGCTGGGGGCAGGGACTGTGGG + Intergenic
934855937 2:97730312-97730334 CAGCTGGGTGCCTCTTCTGCTGG + Intronic
936088560 2:109486678-109486700 CTGCTGGGTGCAAACTCTGCAGG - Intronic
937909573 2:127068887-127068909 CGGGTCGGGGCAGCGTCTGCAGG - Intronic
938572294 2:132571675-132571697 CTACTGGGTGCACCATCTGGGGG + Intronic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
944412675 2:199458620-199458642 TCGCTGGGTGCCGCGTCTGCCGG + Intronic
944676068 2:202034711-202034733 CTGCTGGGCGCACTGTCCGCGGG + Exonic
945128036 2:206535117-206535139 CTCCTGGGTGCAGCATTAGCAGG + Intronic
945142300 2:206699750-206699772 CTGCTCGGTGCACTCTCTGCAGG - Exonic
947794920 2:232888627-232888649 CTGCTGGGTGCCACACCTGCGGG - Intronic
947982489 2:234422180-234422202 CTACTGTGTGCAGCCTCTACAGG + Intergenic
947999977 2:234559840-234559862 CTGCTGTGTCCTGTGTCTGCAGG - Intergenic
948334097 2:237194200-237194222 CTGCTGGGAGCATGGGCTGCTGG + Intergenic
948770326 2:240248430-240248452 CTGCTGGTTGCAGCTGGTGCTGG - Intergenic
948777846 2:240299151-240299173 AAGCTGGGTGCAGCCCCTGCAGG - Intergenic
948972787 2:241442098-241442120 CAGCCGGATGCAGCGCCTGCTGG + Intronic
1171217498 20:23362608-23362630 CTGCGGGTAGCAGCGTCTCCTGG + Intronic
1171412041 20:24953901-24953923 CTGCTGGGTGCAGAGGGTGATGG - Intronic
1171512315 20:25696063-25696085 CTGCGTGGGGCAGCGTCCGCGGG - Intronic
1172227163 20:33312726-33312748 GTGCTGGGAGCAGAGGCTGCTGG - Intergenic
1173640303 20:44597163-44597185 ATGCTGGGTGGAGCGACTGAGGG - Intronic
1173679596 20:44868569-44868591 CTGCTGGGAGCATTGGCTGCTGG - Intergenic
1174103715 20:48147218-48147240 CTGCTGGGTCCAGCGTAATCAGG - Intergenic
1175184276 20:57169521-57169543 CTGATGGGTGCAGGATGTGCTGG - Exonic
1175224050 20:57434492-57434514 CTGCCGAGCGCAGTGTCTGCAGG + Intergenic
1175716885 20:61260934-61260956 CTGCATGGTGCATCATCTGCAGG + Intronic
1178076734 21:29019416-29019438 CTGTTGGGAGCCGCGTCCGCCGG + Intergenic
1179204974 21:39267974-39267996 CTGCTGTGTGCAGGATGTGCAGG - Intronic
1179255848 21:39714616-39714638 CTGCTGGTTGCTGCAGCTGCTGG + Intergenic
1179923580 21:44520646-44520668 CTGCTGGGTGGAGGGGCTCCAGG + Intronic
1180130663 21:45825002-45825024 CTGCAGGGTGCAGGGCTTGCAGG - Intronic
1180253452 21:46605631-46605653 CTGCTGAGGCCAGTGTCTGCAGG + Intergenic
1180542493 22:16463715-16463737 CTGCTGTGTGCTGCTGCTGCTGG + Intergenic
1181079885 22:20406837-20406859 CTGCTGGGTGCAGGGGATGCTGG + Exonic
1181590945 22:23884353-23884375 CTGCTGCCTGCATGGTCTGCGGG + Exonic
1182354222 22:29715056-29715078 CTGCTGGGGACAGTGTCTGGAGG + Intergenic
1183159461 22:36102167-36102189 CTGCTCTGTGCAGTGTCAGCTGG - Intergenic
1183678249 22:39311822-39311844 CTGCTGGGTGGACAGTCAGCTGG + Intergenic
1184095575 22:42314573-42314595 CTCCTGGGTGCAGGACCTGCGGG - Intronic
1184694815 22:46133395-46133417 CTGCAGGCTGCATCATCTGCGGG - Intergenic
1185008538 22:48299958-48299980 CTGCTGGAGGCCCCGTCTGCCGG - Intergenic
1185038421 22:48491162-48491184 CTGCAGGGAGCAGGGTCTGGGGG + Intronic
1185045863 22:48528464-48528486 GGGCTGGGTGCAGTGGCTGCAGG - Intronic
1185291604 22:50030343-50030365 CTGGAGGATGCAGCGGCTGCTGG + Intronic
949984940 3:9533142-9533164 CTGCTTGCTGTAGCATCTGCTGG + Intronic
950003065 3:9672490-9672512 CAGCTGGGTGCATCGGCTGGAGG - Intronic
950553209 3:13680060-13680082 CTGCTGGGTGCTGCAGCTGTGGG - Intergenic
952271960 3:31841717-31841739 CTGGTGGGGGCAGAGTGTGCAGG - Intronic
952980270 3:38728505-38728527 CTGCTGGGGGCACTGTCTCCTGG - Intronic
953775505 3:45813173-45813195 ATGCTGGATGCAGCTTCAGCAGG - Intergenic
954131921 3:48565220-48565242 GTGCTGGGAGCAGTGGCTGCTGG + Intronic
954658637 3:52214074-52214096 CAGCTGAGTGCAACTTCTGCAGG + Exonic
955074907 3:55604493-55604515 CTGCTGAGTGTAGTGTCAGCAGG - Intronic
955395456 3:58554077-58554099 CTGCAGGGTACAGCCCCTGCGGG + Intergenic
955949199 3:64225139-64225161 CTGCTGGATCCAGACTCTGCTGG + Exonic
956784819 3:72633711-72633733 CTGCTGGGGTCAGCGTGAGCTGG - Intergenic
956952634 3:74299730-74299752 CTGGTGGGTGCTGCTGCTGCTGG - Intronic
960601446 3:119463086-119463108 CCGCTGGATGCAGGGGCTGCTGG + Intronic
962919125 3:139935392-139935414 GTGCTGGGTGCCGCTCCTGCTGG + Exonic
967017961 3:185498594-185498616 GTGCTGGCTGCAGGGTGTGCAGG - Intronic
968289196 3:197525742-197525764 CTGCTGGCTGCAGACTCTGGTGG + Intronic
969136840 4:5036220-5036242 CTGCTGGGTGCAGTGTGCACGGG + Intergenic
969508881 4:7605844-7605866 CCACTGGCTGCAGCCTCTGCTGG - Intronic
977947978 4:102935936-102935958 CTGCTGTGTGCTGCTGCTGCTGG + Intronic
978084328 4:104631861-104631883 ATGGTGGGTGCAGTTTCTGCAGG + Intergenic
982668248 4:158291897-158291919 CTGCTGGCAGCAGCCTCAGCAGG - Intergenic
982670844 4:158318688-158318710 CTGCTTCATGCAGCATCTGCGGG + Intronic
984844589 4:184098740-184098762 CAGCTGGCTGCAGCCTCTGTAGG - Intronic
985678194 5:1243064-1243086 CTGCTGGGTGCAGCGTCTGCTGG - Intronic
987026734 5:13934329-13934351 CTGCTGGGTGGTTCTTCTGCAGG - Intronic
990354099 5:54948774-54948796 GTGCTGGATGCAGCTTCTACTGG + Intergenic
990766444 5:59189054-59189076 CTGCTGGGTGAAGTGGCTGAGGG + Intronic
997435756 5:133873834-133873856 CTGCTGGTGGCAGTGTATGCTGG - Intergenic
1000949466 5:167462853-167462875 CTGGAGGGTGGAGCGTTTGCTGG + Intronic
1001031465 5:168266389-168266411 CTGCTGGCTGCATCTACTGCAGG - Intergenic
1001253932 5:170169400-170169422 CCGCTGGGTGCAGCATGAGCAGG + Intergenic
1001389429 5:171366829-171366851 CTTCTGGGAGCTGCGTCTGTTGG + Intergenic
1002163937 5:177333051-177333073 CTGCTGGTGGCAGCTTGTGCAGG - Intronic
1002424451 5:179167052-179167074 CTGCTGGGGTCAGCATCTGCCGG - Intronic
1002611716 5:180423775-180423797 CTGCTGTTTCCAGCGTCTGGTGG + Intergenic
1004790573 6:19021860-19021882 CTGCTGCGTGCGACGCCTGCAGG - Intergenic
1007719051 6:43874630-43874652 CTGGTGGCTGCAGTGCCTGCAGG + Intergenic
1007735952 6:43982300-43982322 CAGCTGGGTGAAGAGGCTGCTGG - Intergenic
1010028391 6:71245801-71245823 CTGCTGGGTGGCCCGGCTGCTGG - Intergenic
1014137677 6:117907668-117907690 CAGCCGGGTGCATCGTGTGCCGG - Exonic
1014272401 6:119349272-119349294 CCGCTGGCTGCAGCCCCTGCGGG + Exonic
1015856036 6:137625480-137625502 CTACTGGGTGCAGGCTCTGACGG - Intergenic
1018104413 6:160469180-160469202 CTGCTGGCTGCAGCCACTCCGGG + Intergenic
1018169383 6:161132461-161132483 CTGCTGAGTGCGGCATCTGCAGG - Exonic
1018937426 6:168282981-168283003 CTGATGGGGGCAGAGACTGCAGG + Intergenic
1019255073 7:44419-44441 GTCCTGGGTGCAGTGTGTGCGGG - Intergenic
1019255081 7:44481-44503 GTCCTGGGTGCAGTGTGTGCGGG - Intergenic
1019255099 7:44611-44633 GTCCTGGGTGCAGTGTGTGCGGG - Intergenic
1019330591 7:458734-458756 ACCCTGGGTGCAGCGTCTGGGGG - Intergenic
1019512087 7:1422705-1422727 GGGCAGGGGGCAGCGTCTGCAGG - Intergenic
1019695657 7:2444721-2444743 TGGCTGGGTGGAGAGTCTGCGGG + Intergenic
1020163911 7:5793608-5793630 CGGCTGCGTGCAGCGCTTGCGGG + Intergenic
1024058136 7:45679259-45679281 CTGCTGTGTTCAGTGTCTGTGGG - Intronic
1026036513 7:66833585-66833607 CTGCTGGGGGCGGGGTCTGGTGG + Intergenic
1026037588 7:66840501-66840523 CTGCTGGGGGCAAGGTCTGGTGG + Intergenic
1026982965 7:74537548-74537570 GTGCTGGGGGCAGGGTCTGGTGG - Intronic
1027214084 7:76173151-76173173 TTGCTGGGGGCAGGGTCTGGTGG - Intergenic
1029359387 7:100077381-100077403 CTCCTGGGTGCAGACTCAGCGGG + Exonic
1029741783 7:102495230-102495252 TTGCGGGGTGCAGCGGCAGCGGG - Intronic
1029759774 7:102594399-102594421 TTGCGGGGTGCAGCGGCAGCGGG - Intronic
1029777136 7:102690309-102690331 TTGCGGGGTGCAGCGGCAGCGGG - Intergenic
1032502418 7:132409920-132409942 ATGCTGGGTGAAGAGTCTGGGGG - Intronic
1033284141 7:140026369-140026391 GTGCTGGGGGCAGAGTGTGCCGG + Intronic
1036175370 8:6532805-6532827 CTGCTGGGTGCGGCCACTGTGGG + Intronic
1037524135 8:19708277-19708299 CTCCTAGGTGCTGAGTCTGCTGG - Intronic
1038164246 8:25069360-25069382 CTGCTGAGTGCAGAGGTTGCAGG - Intergenic
1046353423 8:113046537-113046559 CTGCTGGATGCAGCGTCGATTGG + Intronic
1047335863 8:123935600-123935622 CTTCTGGGTGCAGACCCTGCTGG + Intronic
1047906835 8:129481514-129481536 AGGCTGGGAGCCGCGTCTGCTGG + Intergenic
1048981735 8:139706065-139706087 CTGCAGAGCGCGGCGTCTGCCGG - Intergenic
1049344791 8:142133086-142133108 CGGCTGCGTGCAGCGTGTCCTGG - Intergenic
1049519592 8:143081087-143081109 CCGCTGGCTGTGGCGTCTGCTGG + Exonic
1049621259 8:143599328-143599350 CTGCTGGCTGCTGGGCCTGCGGG + Exonic
1049687998 8:143946676-143946698 CTGCTGGGCGGGGGGTCTGCTGG - Intronic
1049689473 8:143952441-143952463 CTGGTGGGTGGAGGGTCCGCAGG - Intronic
1051459462 9:17295167-17295189 GGGCTGCGTGCAGCGCCTGCGGG - Intronic
1058619006 9:106863667-106863689 CTGCTGGCTGCTGCTCCTGCTGG + Intronic
1059974187 9:119698223-119698245 CTGCCGGGTTCAGAGGCTGCTGG - Intergenic
1060818804 9:126650086-126650108 CTCCTGGCTGCTGCCTCTGCTGG - Intronic
1060877205 9:127091974-127091996 CTGCTGGCTGCAGGTGCTGCAGG - Intronic
1061410373 9:130417794-130417816 CAGCTTGCTGCAGCATCTGCAGG + Intronic
1061860704 9:133467348-133467370 CTGCAGGCTGCGGGGTCTGCGGG - Intronic
1061887339 9:133598491-133598513 CAGCTGTGTGCTGCGTGTGCTGG + Intergenic
1062089145 9:134665568-134665590 CGGCTGGGTGCACAGGCTGCAGG + Intronic
1062364694 9:136203144-136203166 CTGCTGGGCGCTGCGCCCGCGGG + Exonic
1062516561 9:136939886-136939908 CTGCTGGGTCCAGAGTCGGCAGG - Intronic
1062516585 9:136939970-136939992 CTGCTGGGTCCAGAGTTGGCAGG - Intronic
1062516606 9:136940057-136940079 CTGCTGGGTCCAGAGTCGGCAGG - Intronic
1186525202 X:10241936-10241958 CTCCAGGGTACAGTGTCTGCAGG + Intergenic
1187188473 X:17010460-17010482 CTGCTGGGTAATGCTTCTGCAGG + Intronic
1189261657 X:39683201-39683223 CAGCTGGGTGGATCTTCTGCTGG - Intergenic
1190055779 X:47180235-47180257 GTGGTGGGTGCAGGGCCTGCAGG - Exonic
1193408852 X:81139644-81139666 CTGCACTGTGCAGCTTCTGCTGG - Intronic
1200033230 X:153312761-153312783 CTGCTGCGTGCAGGGACTGCAGG + Intergenic
1201987734 Y:19987800-19987822 TTGCTGGCTGCTGGGTCTGCTGG + Intergenic