ID: 985678380

View in Genome Browser
Species Human (GRCh38)
Location 5:1243823-1243845
Sequence CGCTGTCCAGACGCCCCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 460}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985678368_985678380 20 Left 985678368 5:1243780-1243802 CCCTGGAGGACCCGTCCCCAGCA 0: 1
1: 0
2: 1
3: 22
4: 181
Right 985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 460
985678366_985678380 26 Left 985678366 5:1243774-1243796 CCGCCGCCCTGGAGGACCCGTCC 0: 1
1: 0
2: 0
3: 17
4: 169
Right 985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 460
985678373_985678380 4 Left 985678373 5:1243796-1243818 CCCAGCATCTGACTGTCCACTCC 0: 1
1: 0
2: 1
3: 14
4: 202
Right 985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 460
985678374_985678380 3 Left 985678374 5:1243797-1243819 CCAGCATCTGACTGTCCACTCCC 0: 1
1: 0
2: 0
3: 16
4: 260
Right 985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 460
985678369_985678380 19 Left 985678369 5:1243781-1243803 CCTGGAGGACCCGTCCCCAGCAT 0: 1
1: 0
2: 1
3: 20
4: 171
Right 985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 460
985678371_985678380 9 Left 985678371 5:1243791-1243813 CCGTCCCCAGCATCTGACTGTCC 0: 1
1: 0
2: 3
3: 51
4: 334
Right 985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 460
985678370_985678380 10 Left 985678370 5:1243790-1243812 CCCGTCCCCAGCATCTGACTGTC 0: 1
1: 0
2: 3
3: 28
4: 274
Right 985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 460
985678367_985678380 23 Left 985678367 5:1243777-1243799 CCGCCCTGGAGGACCCGTCCCCA 0: 1
1: 0
2: 1
3: 17
4: 267
Right 985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 460
985678372_985678380 5 Left 985678372 5:1243795-1243817 CCCCAGCATCTGACTGTCCACTC 0: 1
1: 0
2: 3
3: 22
4: 220
Right 985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG 0: 1
1: 0
2: 0
3: 12
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985678380 Original CRISPR CGCTGTCCAGACGCCCCTCC TGG Intronic
900226620 1:1536141-1536163 CGCCGTCCTGAGCCCCCTCCGGG - Intronic
900238313 1:1603017-1603039 CCCTGGACAGACACCCCTCCGGG - Intergenic
900482594 1:2906411-2906433 TGCTGTCCAGAGGCCCCTGAGGG - Intergenic
900542223 1:3208859-3208881 GCCTGTCCAGAGGCCCCCCCAGG + Intronic
900763252 1:4486929-4486951 CACTGACCAGACGGCCTTCCAGG - Intergenic
900950557 1:5856091-5856113 TGCTGTCCACACTACCCTCCTGG - Intergenic
902062627 1:13658236-13658258 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
902309353 1:15568916-15568938 CGCTGTGCAGACCCCTCCCCTGG - Exonic
902606827 1:17573650-17573672 CGCTGTCCAGCCACTTCTCCAGG + Intronic
903458414 1:23504311-23504333 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
903816385 1:26067194-26067216 CCCTGTCCAGAGGCCTCTGCAGG + Intronic
903894848 1:26596482-26596504 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
903894942 1:26596704-26596726 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
904006061 1:27363976-27363998 CGCTGTCCAGTCTCCGCTGCAGG + Exonic
904795168 1:33052316-33052338 CTCTGCCCAGCCGCCCCTACTGG + Intronic
905427588 1:37896909-37896931 CTCTGCCCAGCCGCCCCTACTGG + Intronic
906487002 1:46241477-46241499 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
906792877 1:48674139-48674161 CTCTGTCCAGAGGACGCTCCTGG + Intronic
908467935 1:64415246-64415268 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
908605567 1:65793380-65793402 CGCCGTCAAGACGACCATCCAGG - Intronic
912668861 1:111607576-111607598 CTCTGCCCAGCCGCCCCTACTGG - Intronic
912668933 1:111607752-111607774 CTCTGCCCAGCCGCCCCTACTGG - Intronic
912790004 1:112640526-112640548 CTCTGCCCGGCCGCCCCTCCTGG + Intronic
912825079 1:112898187-112898209 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
912845002 1:113069791-113069813 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
913078436 1:115360417-115360439 CTCTGCCCAGCCGCCCCACCTGG - Intergenic
914893724 1:151651165-151651187 CTCTGCCCAGCCGCCCCTACTGG - Intronic
915426937 1:155834908-155834930 CTCTGCCCAGCCGCCCCTACTGG + Intronic
915917549 1:159950055-159950077 CGCTCTCAAGACTCTCCTCCTGG + Intergenic
916167740 1:161978593-161978615 CGGTATCCAGGCGTCCCTCCTGG + Intergenic
916320445 1:163498817-163498839 CTCTGTCCGGCCGCCCCGCCTGG - Intergenic
917553383 1:176058198-176058220 CCCTGCCCAGCCGCCCCTTCTGG + Intronic
917582863 1:176396138-176396160 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
917583009 1:176396489-176396511 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
918228660 1:182509602-182509624 CTCTGCCCAGCCGCCCCTACTGG - Intronic
919804798 1:201375214-201375236 CACTGCCCAGCTGCCCCTCCAGG + Intronic
919995079 1:202740518-202740540 CTCTGCCCAGCCGCCCCTACTGG - Intronic
920031647 1:203041057-203041079 AGCTGTCCAGACTCCCCACGGGG - Intronic
921237986 1:213151534-213151556 CTCTGCCCAGCCGCCCCTACTGG - Intronic
922102590 1:222488094-222488116 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
922102746 1:222488447-222488469 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
923792908 1:237127348-237127370 CTCTGCCCAGCCGCCCCTACTGG - Intronic
924382195 1:243475108-243475130 CTCTGTCCTGCAGCCCCTCCCGG + Intronic
924954224 1:248911682-248911704 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1066952960 10:42138431-42138453 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1067334449 10:45348533-45348555 CTCTGGCCAGCCGCCCCACCTGG + Intergenic
1068673295 10:59744541-59744563 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1069052564 10:63811338-63811360 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1071616528 10:87080901-87080923 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1072116708 10:92375435-92375457 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1072149835 10:92675024-92675046 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1072180570 10:92975973-92975995 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1073293558 10:102425128-102425150 CTTTGTCCAGACACACCTCCCGG - Exonic
1073450738 10:103607455-103607477 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1074588066 10:114787458-114787480 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1075083485 10:119399008-119399030 CCTTGTCCAGAAGCCCCTGCTGG + Intronic
1075993339 10:126856832-126856854 CACTGTCCAGAGACTCCTCCAGG + Intergenic
1076775024 10:132690578-132690600 CACTGTCCAGAGGTCACTCCAGG + Intronic
1077078010 11:709918-709940 GGCTGGCCAGGCCCCCCTCCTGG - Intronic
1077329327 11:1977068-1977090 CCCTCTACAGATGCCCCTCCTGG + Intronic
1080760577 11:35245225-35245247 CTCTGCCCAGACCCCCTTCCTGG + Intergenic
1081574689 11:44311560-44311582 CGCTGTCCGCACGGCCTTCCAGG - Intergenic
1081956330 11:47097203-47097225 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1082844742 11:57716774-57716796 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1082989348 11:59194016-59194038 CGGTGTCCAGGCCCTCCTCCAGG + Intronic
1083030307 11:59585598-59585620 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1083091007 11:60200854-60200876 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1083091146 11:60201176-60201198 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1083115132 11:60451828-60451850 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1083669609 11:64292528-64292550 CGCTGTCCGGCCTCTCCTCCGGG + Intronic
1083832563 11:65242125-65242147 CGATGTCCAGACGGCCCCCTGGG + Intergenic
1084186919 11:67477994-67478016 CTCTGCCCGGCCGCCCCTCCTGG - Intergenic
1084268029 11:68014885-68014907 CCCTGCCCTGATGCCCCTCCTGG - Intronic
1085320783 11:75572590-75572612 GTCTGCCCAGAAGCCCCTCCTGG - Exonic
1085359968 11:75877670-75877692 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1085360016 11:75877797-75877819 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1085803635 11:79614328-79614350 CTATGCCCAGAGGCCCCTCCTGG - Intergenic
1086122265 11:83316170-83316192 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1086366220 11:86111078-86111100 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1086366371 11:86111429-86111451 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1086881531 11:92157772-92157794 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1086881688 11:92158165-92158187 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1088658844 11:112026878-112026900 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1202812306 11_KI270721v1_random:32247-32269 CCCTCTACAGATGCCCCTCCTGG + Intergenic
1091566387 12:1651698-1651720 CCCTGACCAGAAGCCCCTCCTGG - Intergenic
1094238911 12:28200838-28200860 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1095439633 12:42228074-42228096 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1095571174 12:43685413-43685435 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1096441216 12:51645258-51645280 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1097127873 12:56789241-56789263 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1098161292 12:67649487-67649509 AGCTGTCCAAACCCACCTCCCGG + Intronic
1100565666 12:95791010-95791032 GGCTGCCCTGGCGCCCCTCCTGG + Intronic
1100995014 12:100294317-100294339 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1103682895 12:122708819-122708841 CTCTGCCCGGCCGCCCCTCCTGG - Intergenic
1103736223 12:123062426-123062448 TGCTGTCCACAGGCACCTCCAGG - Intronic
1104712812 12:130997239-130997261 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1104855848 12:131902183-131902205 AGCTGTCCAGGAGCCCCGCCTGG + Intronic
1105038758 12:132945690-132945712 CACTGACCAGAGGCCACTCCAGG - Exonic
1105976695 13:25480055-25480077 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1105976769 13:25480230-25480252 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1105980318 13:25512571-25512593 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1106560083 13:30839536-30839558 CTCTGCCCGGACGCCCCTACTGG - Intergenic
1107165914 13:37280593-37280615 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1107364493 13:39655852-39655874 CGTTGTCCAGCCGCGTCTCCAGG - Exonic
1107588769 13:41881627-41881649 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1108370289 13:49761839-49761861 CTCTGCCCAGACGCCCCGTCTGG + Intronic
1108370449 13:49762296-49762318 CTCTGCCCAGCCGCCCCTGCTGG + Intronic
1110269507 13:73575232-73575254 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1113347958 13:109499098-109499120 CGCTTTCCAGAACCCCCTCATGG - Intergenic
1113880416 13:113622402-113622424 TGTTGCCCTGACGCCCCTCCCGG + Intronic
1113933007 13:113978267-113978289 CGGGGTGCAGACGTCCCTCCAGG - Exonic
1114174826 14:20310226-20310248 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1114174951 14:20310529-20310551 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1116480566 14:45389697-45389719 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1117596920 14:57333906-57333928 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1118148757 14:63166024-63166046 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1119710857 14:76821751-76821773 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1119710954 14:76821976-76821998 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1121142746 14:91557224-91557246 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1121142823 14:91557401-91557423 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1122212392 14:100181232-100181254 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1122649952 14:103220750-103220772 CGCTATCCAGGCGCCCGCCCAGG + Intergenic
1123048630 14:105530262-105530284 CGCCCTCCACACACCCCTCCTGG - Intergenic
1202917658 14_GL000194v1_random:190906-190928 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1124132521 15:27003786-27003808 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1125079347 15:35656469-35656491 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1125659355 15:41382934-41382956 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1125758843 15:42083740-42083762 TGCTGTCCAGATGCACATCCAGG + Exonic
1125877925 15:43167099-43167121 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1126125645 15:45292973-45292995 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1126547078 15:49885679-49885701 CCTTAACCAGACGCCCCTCCTGG + Intronic
1127782893 15:62332314-62332336 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1128489802 15:68134778-68134800 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1128490042 15:68135302-68135324 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1128587143 15:68860246-68860268 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1129054048 15:72807017-72807039 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1129428645 15:75481851-75481873 GCCTGGCCAGCCGCCCCTCCGGG + Intronic
1129431307 15:75503648-75503670 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1129431446 15:75503956-75503978 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1129431599 15:75504309-75504331 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1130946198 15:88552465-88552487 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1131125434 15:89854447-89854469 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1131549143 15:93341739-93341761 TCCTGTCCAGACCTCCCTCCAGG + Intergenic
1132982407 16:2745246-2745268 CCCTGTGCAGAGGCCCCTCCAGG - Intergenic
1133709302 16:8385700-8385722 CACTGTCCAGGTGCCCTTCCAGG - Intergenic
1134854173 16:17505704-17505726 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1134854249 16:17505881-17505903 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1136580512 16:31148599-31148621 CGCCGTCCAGGGGCCCGTCCTGG + Exonic
1137236464 16:46622390-46622412 AGCTTTCCAGTCACCCCTCCTGG - Intergenic
1137240727 16:46653224-46653246 CTCTGCCCAGCCGCCCCTTCTGG - Intergenic
1142533674 17:598924-598946 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1142949285 17:3464945-3464967 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1144524641 17:15979729-15979751 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1144798921 17:17912218-17912240 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1145206007 17:20984996-20985018 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1145684282 17:26638424-26638446 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1145684414 17:26638800-26638822 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1146216257 17:30980144-30980166 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1146695693 17:34907702-34907724 CGCTGCCCGGCCGCCCCTTCTGG + Intergenic
1146731212 17:35195040-35195062 CGCTGCCCGGCCGCCCCTTCTGG - Intergenic
1147709128 17:42449462-42449484 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1147963519 17:44180982-44181004 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1148086700 17:44997950-44997972 CGCAGCCCAGAGGCCCCTGCAGG + Intergenic
1148404413 17:47398165-47398187 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1148406536 17:47420916-47420938 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1149633114 17:58142808-58142830 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1149909072 17:60551851-60551873 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1149909144 17:60552027-60552049 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1152129205 17:78465861-78465883 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1152922488 17:83072963-83072985 CTCCCTCCAGAAGCCCCTCCAGG - Intergenic
1154398167 18:14010648-14010670 CTCTGTCCAGCCGCCCCTACTGG - Intergenic
1154420263 18:14223003-14223025 CTCTGTCCAGCCGCCCCATCTGG + Intergenic
1156159290 18:34340948-34340970 CTCTGCCCTGACTCCCCTCCAGG + Intergenic
1157629375 18:49080447-49080469 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1158459216 18:57632768-57632790 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1160298597 18:77658797-77658819 CACTGCCCAGATGCCCCTTCAGG - Intergenic
1163143096 19:15363281-15363303 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1163905794 19:20149829-20149851 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1163909360 19:20175895-20175917 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1163945147 19:20529646-20529668 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1163986071 19:20952612-20952634 CTCTGCCCAGCCGCCCCTTCTGG - Intergenic
1164192234 19:22926476-22926498 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1164298358 19:23937021-23937043 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1164835315 19:31351765-31351787 CGCTGTGCACACGCCGCACCGGG - Intergenic
1165045682 19:33103105-33103127 AGATGGCCAGACACCCCTCCTGG - Intronic
1165373081 19:35422266-35422288 CGCTGAGCAGAAGGCCCTCCAGG + Intergenic
1165725056 19:38106866-38106888 AGCTAGCCCGACGCCCCTCCAGG + Intronic
1165727652 19:38124035-38124057 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1165742321 19:38211479-38211501 TGGTGTCCACCCGCCCCTCCTGG - Intronic
1166029998 19:40118517-40118539 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1166191751 19:41180614-41180636 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1166191868 19:41180885-41180907 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1166261649 19:41644931-41644953 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1166425774 19:42676581-42676603 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1166558118 19:43715090-43715112 CTCTGTCCTGTCTCCCCTCCGGG - Intergenic
1167129293 19:47573544-47573566 CGCTGCTCAGAGGCCCCTCCGGG - Intergenic
1167823688 19:51952902-51952924 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1168658355 19:58147473-58147495 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1168658505 19:58147825-58147847 CTCTGCCCAGCCGCCCCTACTGG + Intronic
925335432 2:3095651-3095673 AGCAGTCCAGAAGCCCCACCCGG + Intergenic
926322586 2:11759744-11759766 CTCTGCCCAGCCGCCCCTTCTGG - Intronic
926674901 2:15611849-15611871 CTCTGCCCAGCCGCCCCTACTGG - Intronic
927354048 2:22152625-22152647 CTCTGTCCAGAAGCCTCTCCTGG + Intergenic
927833026 2:26370422-26370444 CTCTGCCCAGCCGCCCCTACTGG - Intronic
927851572 2:26503261-26503283 CCCTCTCCAGTCGCTCCTCCGGG + Intronic
928541998 2:32293777-32293799 CTCTGCCCAGCCGCCCCTACTGG - Intronic
928542122 2:32294053-32294075 CTCTGCCCAGCCGCCCCTACTGG - Intronic
929416363 2:41747723-41747745 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
929447731 2:42014470-42014492 CTCTGCCCGGACGCCCCTACTGG - Intergenic
929690237 2:44067362-44067384 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
931238534 2:60432515-60432537 CGCCTCCCAGACGCCCCTCCTGG + Intergenic
931584333 2:63809342-63809364 CTCTGCCCAGCCGCCCCTACTGG + Intronic
932807294 2:74795652-74795674 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
932807462 2:74796054-74796076 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
936546321 2:113394778-113394800 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
937919468 2:127119769-127119791 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
938088959 2:128418935-128418957 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
938156150 2:128941922-128941944 AGCTGCCAAGACCCCCCTCCTGG - Intergenic
938716725 2:134028087-134028109 CACTGCCCAGCCGCCACTCCCGG - Intergenic
939186956 2:138872269-138872291 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
940299327 2:152160928-152160950 CTCTGCCCAGCCGCCCCTACTGG + Intronic
940652227 2:156451354-156451376 CTCTGCCCAGCCGCCCCTACTGG - Intronic
940652348 2:156451629-156451651 CTCTGCCCAGCCGCCCCTACTGG - Intronic
941197659 2:162470676-162470698 CTCTGCCCAGCCGCCCCTACTGG + Intronic
941602988 2:167563599-167563621 CTCTGCCCAGCCGCCCCTGCTGG - Intergenic
941768891 2:169327364-169327386 CTCTGCCCAGCCGCCCCTACTGG + Intronic
941769217 2:169328116-169328138 CTCTGCCCAGCCGCCCCTACTGG + Intronic
942630474 2:177946384-177946406 CTCTGCCCAGCCGCCCCTACTGG + Intronic
943323693 2:186473626-186473648 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
943739976 2:191398354-191398376 CTCTGCCCAGCCGCCCCTACTGG - Intronic
944060828 2:195568255-195568277 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
944262940 2:197696121-197696143 CTCTGCCCAGCCGCCCCTACTGG - Intronic
946318219 2:218931777-218931799 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
947402489 2:229743262-229743284 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
947722811 2:232379882-232379904 CGATGTCCTGGCACCCCTCCTGG - Exonic
947727154 2:232407963-232407985 CGATGTCCTGGCACCCCTCCTGG - Exonic
947736312 2:232457268-232457290 CGATGTCCTGGCACCCCTCCTGG - Exonic
948083519 2:235227041-235227063 CGCTGTCCAGGAGCCCATCAGGG + Intergenic
948347200 2:237308482-237308504 CACTGTCCAGACCCTCCTTCAGG - Intergenic
1168765692 20:380752-380774 CACTGACCAGACGCCCCTAGGGG + Exonic
1169167978 20:3440996-3441018 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1170424830 20:16227408-16227430 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1170592206 20:17779294-17779316 CTCTGCCCAGCCGCCCCTTCTGG + Intergenic
1170811569 20:19678574-19678596 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1171861420 20:30405461-30405483 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1171951682 20:31427223-31427245 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1171951852 20:31427597-31427619 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1171951952 20:31427851-31427873 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1171957010 20:31470491-31470513 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1171957130 20:31470766-31470788 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1171957331 20:31471246-31471268 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1172199675 20:33115891-33115913 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1172663176 20:36581321-36581343 GGCTGTCCAGACACTCCTCGAGG - Intronic
1172735886 20:37126183-37126205 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1173769533 20:45645838-45645860 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1174357780 20:50009953-50009975 CGCAGCCCGGGCGCCCCTCCAGG + Intergenic
1176221964 20:63974021-63974043 GGTTGCCCAGACGCCCCTCCAGG + Intronic
1176390143 21:6159053-6159075 CCCTGCCCCGACTCCCCTCCTGG + Intergenic
1176656649 21:9593673-9593695 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1178034463 21:28564219-28564241 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1179733323 21:43379187-43379209 CCCTGCCCCGACTCCCCTCCTGG - Intergenic
1179969221 21:44825002-44825024 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1180609253 22:17085118-17085140 CGCTGTCCCGGGGCCCCTGCTGG + Exonic
1180858108 22:19060813-19060835 CGCTCTCCAGGCGCTCCCCCAGG - Intronic
1180861441 22:19084860-19084882 CTCTGCCCAGCCGCCCCTTCTGG + Intronic
1181014966 22:20063576-20063598 CCCTGTCCAGACGCAGCTGCAGG + Intronic
1183434778 22:37787030-37787052 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1183595453 22:38807662-38807684 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1183841311 22:40501740-40501762 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1183841384 22:40501916-40501938 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1183995682 22:41631202-41631224 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1184291814 22:43501447-43501469 TGCTCTCCAGACGCCCCGCCCGG + Intronic
1185280837 22:49969223-49969245 CGCTGCCCAGGAGCTCCTCCGGG - Intergenic
1203247427 22_KI270733v1_random:84858-84880 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
950060898 3:10070431-10070453 CTCTGCCCAGCCGCCCCTACTGG + Intronic
950412659 3:12849591-12849613 CTCTGCCCAGCCGCCCCTACTGG - Intronic
950754850 3:15163175-15163197 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
950897855 3:16469668-16469690 TGCTGGCCTGAGGCCCCTCCAGG + Intronic
951013403 3:17704936-17704958 CTCTGCCCAGCCGCCCCTACTGG - Intronic
952747578 3:36795593-36795615 CCCTGCCCAGAAGCCCCTCCAGG + Intergenic
953652704 3:44821190-44821212 CTCTGCCCAGCCGCCCCTACTGG - Intronic
954060434 3:48061930-48061952 CTCTGCCCAGCCGCCCCTTCTGG + Intronic
954080867 3:48211866-48211888 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
954162847 3:48734565-48734587 CTCTGCCCAGCCGCCCCTACTGG + Intronic
954483471 3:50823729-50823751 CTCTGCCCAGCCGCCCCTACTGG - Intronic
954523519 3:51249429-51249451 CTCTGTCCGGCCGCCCCTACTGG + Intronic
955362958 3:58290229-58290251 CTCTGCCCAGCCGCCCCTACTGG - Intronic
955363030 3:58290404-58290426 CTCTGCCCAGCCGCCCCTACTGG - Intronic
956270701 3:67444744-67444766 CTCTGCCCAGCCGCCCCTACTGG + Intronic
956270776 3:67444922-67444944 CTCTGCCCAGCCGCCCCTACTGG + Intronic
958406619 3:93762529-93762551 CTCTGCCCAGCCGCCCCACCTGG - Intergenic
958406772 3:93763051-93763073 CTCTGCCCAGCCGCCCCACCTGG - Intergenic
958407217 3:93764628-93764650 CTCTGTCCAGTCGCCCCATCTGG - Intergenic
959042831 3:101439827-101439849 CTCTGCCCAGCCGCCCCTACTGG + Intronic
959221894 3:103531475-103531497 CTCTGCCCAGCCGCCCCTGCTGG - Intergenic
959419274 3:106111666-106111688 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
960388707 3:117050909-117050931 CTCTGCCCAGCCGCCCCTACTGG + Intronic
960780413 3:121313278-121313300 CTCTGCCCAGCCGCCCCTACTGG - Intronic
960921101 3:122747685-122747707 CTCTGCCCAGCCGCCCCTACTGG + Intronic
960921154 3:122747812-122747834 CTCTGCCCAGCCGCCCCTACTGG + Intronic
961163864 3:124750499-124750521 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
963036079 3:141030411-141030433 CTCTGCCCAGCCGCCCCTTCTGG - Intergenic
963451185 3:145482989-145483011 CTCTGCCCAGCCGCCCCTACAGG + Intergenic
966359795 3:179120495-179120517 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
966360117 3:179121221-179121243 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
966747104 3:183287679-183287701 CGCTGTCCATAAATCCCTCCTGG - Intronic
966890546 3:184404647-184404669 CGCTGCCCAGACCCCATTCCTGG - Intronic
967524283 3:190473503-190473525 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
967524336 3:190473630-190473652 CTCTGCCCGGACGCCCCTACTGG + Intergenic
968924082 4:3538412-3538434 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
968924177 4:3538637-3538659 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
968924294 4:3538940-3538962 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
969301954 4:6302279-6302301 TGCTGCCCAGGCGGCCCTCCAGG - Exonic
969410002 4:7021907-7021929 TACTGTCCACACGGCCCTCCTGG - Intronic
972304803 4:37820720-37820742 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
972412528 4:38807934-38807956 CTCTGCCCAGCCGCCCCTACTGG + Intronic
974082220 4:57224612-57224634 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
976265184 4:83182534-83182556 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
979057717 4:116016718-116016740 GGCTGTGCAGATGCCTCTCCGGG + Intergenic
980056332 4:128083380-128083402 CTCTGCCCAGCCGCCCCTACTGG - Intronic
980056480 4:128083734-128083756 CTCTGCCCAGCCGCCCCTACTGG - Intronic
982026040 4:151254921-151254943 GCCTGGCCAGCCGCCCCTCCCGG - Intronic
982615599 4:157636388-157636410 CTCTGCCCCGCCGCCCCTCCTGG - Intergenic
982820528 4:159938924-159938946 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
984734998 4:183099806-183099828 CGGCTTCCCGACGCCCCTCCGGG + Intronic
985216422 4:187658296-187658318 CTCTGCCCAGCCGCCCCTTCTGG + Intergenic
985678380 5:1243823-1243845 CGCTGTCCAGACGCCCCTCCTGG + Intronic
985901818 5:2802109-2802131 TGCTGTCCAGACGCAGTTCCAGG - Intergenic
986184325 5:5422288-5422310 CGCTGTCCCGGAGCCCGTCCTGG - Intronic
989021392 5:37013104-37013126 CTCTGCCCAGCCGCCCCTACTGG - Intronic
989211301 5:38861808-38861830 CTCTGCCCAGCCGCCCCTACTGG - Intronic
989575116 5:42980806-42980828 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
989640384 5:43578176-43578198 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
990426664 5:55695958-55695980 CTCTGCCCAGCCGCCCCTACTGG - Intronic
990458936 5:56014788-56014810 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
990459046 5:56015045-56015067 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
990462022 5:56038932-56038954 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
990709199 5:58563600-58563622 CTCTGCCCAGCCGCCCCGCCTGG - Intergenic
992374050 5:76172040-76172062 CTCTGCCCAGCCGCCCCTACTGG + Intronic
992463746 5:76985005-76985027 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
992574526 5:78096939-78096961 CTCTGCCCAGCCGCCCCTACTGG + Intronic
992963972 5:81983117-81983139 CTCTGTCCGGCCGCCCCTACTGG - Intronic
993496713 5:88616246-88616268 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
995123551 5:108559192-108559214 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
995517007 5:112964209-112964231 CACTCTCCAGAGGCCCCACCTGG - Intergenic
997892380 5:137687342-137687364 CTCTGCCCAGCCGCCCCTACTGG + Intronic
998027124 5:138827568-138827590 TGCTTTCCAGACGCTCCTCCAGG - Exonic
998067524 5:139170877-139170899 CTCTGCCCAGCCGCCCCTACTGG + Intronic
998067575 5:139171004-139171026 CTCTGCCCAGCCGCCCCTACTGG + Intronic
999603926 5:153296363-153296385 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
999603998 5:153296538-153296560 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1000985509 5:167859660-167859682 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1001393920 5:171403570-171403592 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1002014214 5:176306343-176306365 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1002222838 5:177696368-177696390 CTCTGCCCAGCCGCCCCACCTGG - Intergenic
1002280548 5:178127536-178127558 CGCCCTCCTGACGCCCCTGCAGG + Intergenic
1005159023 6:22837183-22837205 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1006064657 6:31454666-31454688 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1006064742 6:31454872-31454894 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1006064815 6:31455048-31455070 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1006064911 6:31455273-31455295 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1006065019 6:31455527-31455549 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1006492480 6:34398025-34398047 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1007651541 6:43425425-43425447 CTCTGTCCGGCCGCCCCTTCTGG + Intergenic
1007719276 6:43875780-43875802 CTCTGTCCAGGCACCTCTCCTGG + Intergenic
1008841478 6:55909881-55909903 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1010030225 6:71265973-71265995 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1010245773 6:73660406-73660428 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1010245872 6:73660631-73660653 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1011297403 6:85839114-85839136 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1011588367 6:88948236-88948258 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1011588500 6:88948542-88948564 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1012912839 6:105136979-105137001 CGCTGCCCAGGCTCCCCGCCAGG - Exonic
1012983509 6:105853668-105853690 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1013204669 6:107934774-107934796 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1013204786 6:107935046-107935068 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1013955594 6:115836581-115836603 CTCTGCCCAGCCGCCCCTTCTGG + Intergenic
1014556697 6:122848479-122848501 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1014556829 6:122848785-122848807 CGCTGCCCGGCCGCCCCTACTGG - Intergenic
1015476860 6:133665260-133665282 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1016940860 6:149482007-149482029 GGCTGTCCCTGCGCCCCTCCAGG - Intronic
1017215100 6:151899411-151899433 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1019514880 7:1435197-1435219 GACTGTCCGGAGGCCCCTCCAGG - Intronic
1019719380 7:2559151-2559173 CGCTGCCCGGCCGCCCCTCAGGG - Exonic
1020616317 7:10465541-10465563 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1021672226 7:23045985-23046007 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1021672398 7:23046391-23046413 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1021872466 7:25018933-25018955 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1021872516 7:25019062-25019084 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1021872620 7:25019290-25019312 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1021872697 7:25019469-25019491 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1022083578 7:27045578-27045600 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1022478041 7:30724595-30724617 CCCTGTCCAGGATCCCCTCCAGG + Intronic
1023352004 7:39329740-39329762 TGCTGTCCTCACTCCCCTCCTGG + Intronic
1025821397 7:64967725-64967747 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1025821470 7:64967901-64967923 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1027182879 7:75952348-75952370 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1029539037 7:101172378-101172400 GGCTGTCCACGCGCCACTCCAGG + Exonic
1029569123 7:101359039-101359061 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1030288381 7:107848477-107848499 CTCTGCCCAGCCGCCCCTTCTGG + Intergenic
1030602885 7:111610360-111610382 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1031999824 7:128257651-128257673 AGCTCTCCCGAAGCCCCTCCAGG - Intergenic
1036506952 8:9365064-9365086 CTCTGCCCAGCCGCCCCTCCTGG - Intergenic
1036536636 8:9657536-9657558 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1037355201 8:18011764-18011786 GGATGTCCAGACTTCCCTCCAGG + Exonic
1037420417 8:18695982-18696004 AGCTGCCCAGACACCCCTTCAGG + Intronic
1037730414 8:21519133-21519155 CAGTGTCCAGAAGCCCCACCAGG - Intergenic
1038267404 8:26047499-26047521 TGCTGACCAGAGGCCTCTCCGGG - Intergenic
1039153141 8:34528770-34528792 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1039153195 8:34528897-34528919 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1039153297 8:34529149-34529171 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1041170895 8:55141281-55141303 CCCTCTCCAGACGCATCTCCTGG + Intronic
1042049137 8:64686156-64686178 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1042227053 8:66522276-66522298 AGGTGGCCAGACGCCCCACCTGG + Intergenic
1044223898 8:89699432-89699454 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1044582079 8:93833989-93834011 CCCTGCCCAGCCGCCCCGCCTGG - Intergenic
1044582192 8:93834351-93834373 CTCTGCCCAGCCGCCCCGCCTGG - Intergenic
1044660784 8:94591176-94591198 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1044950991 8:97435159-97435181 AGCTGCTCAGATGCCCCTCCAGG + Intergenic
1045120224 8:99028453-99028475 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1046636661 8:116679688-116679710 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1047687649 8:127317311-127317333 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1047847943 8:128826170-128826192 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1050571852 9:6949046-6949068 CTCTGCCCAGCCGCCCCTTCTGG - Intronic
1052259276 9:26493315-26493337 CTCTGCCCAGCCGCCCCGCCTGG + Intergenic
1052461025 9:28763078-28763100 GCCTCTCCAGAAGCCCCTCCGGG + Intergenic
1053468155 9:38325143-38325165 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1054915819 9:70494417-70494439 GGATGTCCTGACGACCCTCCAGG - Intergenic
1055242155 9:74197802-74197824 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1055586470 9:77762001-77762023 CTCTGCCCGGCCGCCCCTCCTGG + Intronic
1056152548 9:83804176-83804198 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1056564052 9:87758246-87758268 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1056564105 9:87758373-87758395 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1056564155 9:87758500-87758522 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1056564206 9:87758627-87758649 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1056564257 9:87758755-87758777 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1056606876 9:88093222-88093244 CGCTGTACAGACTCGCCTCCTGG + Intergenic
1056706839 9:88959265-88959287 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1057674837 9:97130533-97130555 CTCTGCCCGGCCGCCCCTCCTGG - Intergenic
1058018973 9:100068259-100068281 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1059211208 9:112514731-112514753 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1060065126 9:120496082-120496104 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1060703676 9:125780301-125780323 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1061664682 9:132153638-132153660 CCCTGCCCAGAGGCTCCTCCAGG - Intergenic
1062643851 9:137536358-137536380 TGCTGTCCAGACGCCATCCCAGG - Intronic
1062733494 9:138121756-138121778 CACTGTCCAGACGCTGCCCCAGG - Exonic
1203771928 EBV:53908-53930 CCCTGTCCAGGCTCCCCTCGAGG - Intergenic
1203463759 Un_GL000220v1:67918-67940 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1203405662 Un_KI270539v1:556-578 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1203634362 Un_KI270750v1:97157-97179 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1187183636 X:16965200-16965222 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1189210476 X:39278314-39278336 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1189505911 X:41612581-41612603 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1189968183 X:46395221-46395243 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1189968549 X:46396070-46396092 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1190769687 X:53504373-53504395 CTCTGCCCAGCCGCCCCTTCTGG + Intergenic
1190891441 X:54572569-54572591 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1191010224 X:55749465-55749487 CTCTGTCCGGCCGCCCCTACTGG + Intronic
1192504946 X:71676011-71676033 CTCTGCCCAGACGCCCCGTCTGG + Intergenic
1192567867 X:72179112-72179134 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1192621391 X:72681774-72681796 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1192768598 X:74166707-74166729 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1192768794 X:74167157-74167179 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1193132240 X:77931704-77931726 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1193345197 X:80396964-80396986 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1193924444 X:87466298-87466320 CTCTGCCCAGCCGCCCCTTCTGG + Intergenic
1194611521 X:96051027-96051049 CTCTGCCCAGCCGCCCCTACTGG - Intergenic
1195036008 X:100972420-100972442 CTCTGCCCAGCCGCCCCTACTGG - Intronic
1197736089 X:129850977-129850999 CTCTGCCCAGCCGCCCCTACTGG + Intergenic
1198246911 X:134839615-134839637 CTCTGCCCAGCCGCCCCTACTGG + Intronic
1200952862 Y:8918047-8918069 CTCTCTCCAGCCGCCCCTTCTGG - Intergenic
1201335842 Y:12878983-12879005 CTCTGCCCGGCCGCCCCTCCTGG + Intergenic