ID: 985679009

View in Genome Browser
Species Human (GRCh38)
Location 5:1246332-1246354
Sequence GCGCTTGGCCGGGCTGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985678997_985679009 14 Left 985678997 5:1246295-1246317 CCCGCGGCCTGGGCGTCCTGCAG 0: 1
1: 0
2: 2
3: 24
4: 278
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209
985679002_985679009 -2 Left 985679002 5:1246311-1246333 CCTGCAGCGGCTGAGGTCCCTGC 0: 1
1: 1
2: 0
3: 30
4: 246
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209
985678998_985679009 13 Left 985678998 5:1246296-1246318 CCGCGGCCTGGGCGTCCTGCAGC 0: 1
1: 0
2: 1
3: 25
4: 289
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209
985678996_985679009 23 Left 985678996 5:1246286-1246308 CCTGCTGAGCCCGCGGCCTGGGC 0: 1
1: 0
2: 5
3: 33
4: 306
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209
985679000_985679009 7 Left 985679000 5:1246302-1246324 CCTGGGCGTCCTGCAGCGGCTGA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209
985678994_985679009 24 Left 985678994 5:1246285-1246307 CCCTGCTGAGCCCGCGGCCTGGG 0: 1
1: 0
2: 3
3: 33
4: 254
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985679009 Original CRISPR GCGCTTGGCCGGGCTGGCTC AGG Intergenic
900205518 1:1430549-1430571 CCTCCTGCCCGGGCTGGCTCTGG + Intergenic
900549613 1:3247687-3247709 GCGCTGGCCCGCGCTCGCTCTGG + Intronic
901005387 1:6169386-6169408 GGCCCTGGCCGGGCAGGCTCGGG + Intronic
901242812 1:7704785-7704807 GCGCGGGGCCGGGCTGGGCCGGG + Intronic
902072621 1:13753710-13753732 GAGCTGGGCTGGGCTGGCTAGGG + Intronic
902830837 1:19011193-19011215 GAGCTGGGCCCGCCTGGCTCGGG - Intergenic
903278763 1:22238259-22238281 TCACTGGGCCAGGCTGGCTCTGG + Intergenic
903397146 1:23010534-23010556 AGGCTTGGCAGGGCTGGCTTCGG + Intergenic
903461600 1:23524744-23524766 GCCCTTGGCCAGACTGGCTTTGG - Intronic
904400337 1:30252577-30252599 GGGCTTGGCTGGGCCGCCTCTGG + Intergenic
906117910 1:43367837-43367859 GGGCTGGGCCGGGCTGGGCCGGG + Intronic
906640470 1:47438060-47438082 GGGCTCGGCCGCGCTGCCTCTGG - Exonic
907308144 1:53525010-53525032 CAGCTGGGCCGGGCTGGCTGAGG - Intronic
910094885 1:83510478-83510500 GATCTGGGCTGGGCTGGCTCAGG - Intergenic
910228594 1:84963071-84963093 GTGCTTGGGCAGTCTGGCTCTGG - Intronic
911598208 1:99820755-99820777 GGACTTGGCAGGGCTGGCCCAGG - Intergenic
913172440 1:116244975-116244997 ACGCATGCCCGGGCAGGCTCTGG - Intergenic
919451153 1:197775008-197775030 GAGGTTGGCCGGGCGGGCTGGGG - Intronic
919986951 1:202682062-202682084 TGGCTGGGCTGGGCTGGCTCTGG - Intronic
920914699 1:210250839-210250861 GCGTTGTGCCTGGCTGGCTCCGG - Intergenic
922307449 1:224356835-224356857 GCCCTTGCCGGGGCTGGCTGAGG - Exonic
1062843731 10:689506-689528 GCGCCTGGCCGAGCTGGAGCTGG - Exonic
1063021986 10:2137971-2137993 GCACTTGGAGCGGCTGGCTCTGG - Intergenic
1069594673 10:69663019-69663041 GCTCTTGGCTGGTCTGGCACGGG - Intergenic
1069851425 10:71407610-71407632 GCCATTGGCCAGGCTGGCTCAGG + Intronic
1072415258 10:95241822-95241844 GGGCTTGGCAGGGCTGGACCAGG - Intronic
1075873586 10:125788814-125788836 TCCCTGGGCTGGGCTGGCTCTGG - Exonic
1076210792 10:128643086-128643108 GGGCAGGGCCGTGCTGGCTCTGG - Intergenic
1076371752 10:129959818-129959840 GCACGTGGCCGCGCGGGCTCGGG - Intronic
1076413788 10:130270773-130270795 GCTCCTGGCCAGGCTGGCACAGG - Intergenic
1079004725 11:16783611-16783633 GCCCTGGGCCGGGCTGGCTGGGG - Intronic
1080551517 11:33376736-33376758 GGGCTTGGTCGGGCTGCCTGGGG + Intergenic
1081186940 11:40054836-40054858 GGGCTAGGCTGGGCTGGCTCTGG + Intergenic
1081907599 11:46679499-46679521 GCCCTAGGCTGGGCTGGTTCAGG + Intronic
1083886088 11:65574194-65574216 GTGCTCTGCCTGGCTGGCTCTGG + Intronic
1084086726 11:66858353-66858375 CCGCCTGGCCACGCTGGCTCCGG + Exonic
1084357700 11:68650966-68650988 GCCCTCGGCCGGGCTGCCTTCGG - Intergenic
1084529165 11:69717031-69717053 CCGCTTGGCCTGGCTCCCTCTGG - Intergenic
1084814672 11:71639268-71639290 GCTCTTGGCCAGGCCAGCTCCGG - Intergenic
1088641673 11:111879003-111879025 GCGCCCGGCCGAGTTGGCTCGGG - Exonic
1091286048 11:134409219-134409241 GCCCTTGGCCAGGCTGTCTGAGG - Intronic
1092167747 12:6353426-6353448 GCGCTTAGCTGGGCAGGCTCTGG - Intronic
1094536084 12:31324167-31324189 GCGCCGGGCCGGGCTGGCGCGGG - Intronic
1096157567 12:49348991-49349013 GAGGTGGGCTGGGCTGGCTCTGG + Exonic
1096720421 12:53517087-53517109 GCTCTTGGGCGGGCGAGCTCTGG + Exonic
1100347003 12:93742371-93742393 GCGCTTGGCCGGGCACCCGCGGG + Intronic
1101238199 12:102811344-102811366 GAGCTTGGCGGGGCAGACTCTGG - Intergenic
1101639893 12:106580505-106580527 GAGCTGTGCTGGGCTGGCTCCGG + Intronic
1102581346 12:113890244-113890266 GAGCTGAGCCAGGCTGGCTCTGG + Intronic
1104771968 12:131369236-131369258 GAGCCTGGCAGGGCTGCCTCTGG - Intergenic
1104846645 12:131850396-131850418 GCGTTTGGCAGGGCTGGGGCCGG - Intronic
1112521394 13:100098495-100098517 GCCCTTGGCCAGGCAGGGTCGGG + Intronic
1113530134 13:111018372-111018394 GCGCCAGCCCGGGCTGGCGCTGG + Intergenic
1113851699 13:113421576-113421598 GTGGTTGGCGGGGCTGGCCCGGG + Intergenic
1114552957 14:23544628-23544650 GTGGTTGGCCCGGCTGGCGCGGG + Intronic
1115545495 14:34462189-34462211 GCGCATGGCGGGGATGGCGCTGG - Exonic
1116656904 14:47665470-47665492 GCCCTTCTCCGGGCTGGCTGAGG + Intronic
1118003833 14:61547766-61547788 GCGCTTGGGCAGCCTGACTCAGG + Exonic
1119569754 14:75660308-75660330 GGGCTTGGCTGGGCTGGGCCAGG - Intronic
1119608873 14:76044826-76044848 GCGGTTGGCCTTGCTGTCTCAGG - Intronic
1121407492 14:93727958-93727980 AGGCTGGGCTGGGCTGGCTCAGG - Intronic
1121415153 14:93774295-93774317 CCGCTTGTCCTGGCTGGCCCGGG - Intronic
1122071726 14:99209468-99209490 GCTCTGGGCTGGGCTGGCCCTGG - Intronic
1122870725 14:104637077-104637099 GGTCTTCGCAGGGCTGGCTCAGG - Intergenic
1123056996 14:105575409-105575431 CAGCGTGGCCAGGCTGGCTCAGG + Intergenic
1123057015 14:105575463-105575485 CAGCGTGGCCAGGCTGGCTCAGG + Intergenic
1123057032 14:105575515-105575537 CAGCGTGGCCAGGCTGGCTCAGG + Intergenic
1123081214 14:105696376-105696398 CAGCGTGGCCAGGCTGGCTCAGG - Intergenic
1123084453 14:105711104-105711126 GGGCTGGGCCGGGCTGGGCCGGG - Intergenic
1123794411 15:23757089-23757111 CGGCTTGTCAGGGCTGGCTCAGG - Intergenic
1124625345 15:31304417-31304439 GGGCCTGGCTGGGCTGGCTGGGG + Intergenic
1125677736 15:41511693-41511715 GCGCTGGGCTGGGCTGGCCTGGG - Intronic
1126436595 15:48644638-48644660 TCTCTTGGCCCGACTGGCTCTGG + Exonic
1127765919 15:62185921-62185943 GCTCGTGGTCTGGCTGGCTCAGG + Intergenic
1129263512 15:74382081-74382103 GTGCTGGGCCTGGCTGGCTGAGG - Intergenic
1129299622 15:74618127-74618149 GTGCTTGGCCAGGCAAGCTCAGG + Intronic
1131063304 15:89417514-89417536 GCGTTTGGCCTGGCAGGCTCAGG + Intergenic
1131076225 15:89496554-89496576 GTGCCTGGCCGGGCTGGCAGCGG + Exonic
1132255566 15:100373468-100373490 GCGCCTGGCCGGGCTGCACCGGG - Intergenic
1132519769 16:381802-381824 GCCATGGGCCGGGCTGGCACCGG - Exonic
1133234757 16:4382632-4382654 GCTCCTGGCCGCGCTGGCTGCGG + Exonic
1133286780 16:4694328-4694350 TCCCCTGGCCGGGCTGGGTCGGG + Intronic
1136672717 16:31873064-31873086 CCTCTGGGCCGTGCTGGCTCAGG - Intergenic
1136778209 16:32882581-32882603 GAGGTTGGCCAGGCTGGCACTGG + Intergenic
1136892412 16:33978933-33978955 GAGGTTGGCCAGGCTGGCACTGG - Intergenic
1137531744 16:49282360-49282382 GCGCTGGGCGAGCCTGGCTCAGG + Intergenic
1138360674 16:56425134-56425156 GCGCTCGGCCGGGCGGGCGCCGG + Exonic
1138560479 16:57798109-57798131 GCGGGCGGCCGGGCTGGCTGGGG + Exonic
1141038797 16:80654171-80654193 GCGCTCTGCCGGGCTGGGTTGGG + Intronic
1141576170 16:84964684-84964706 GGGCTTGGCCAGGCTGGGTGTGG + Intergenic
1141582740 16:85011388-85011410 GCTCATGGCCGGGCTGGAGCGGG + Exonic
1142154640 16:88527515-88527537 GCGCGTGAGCGGGCCGGCTCAGG + Intronic
1203080630 16_KI270728v1_random:1144690-1144712 GAGGTTGGCCAGGCTGGCACTGG + Intergenic
1144708939 17:17387934-17387956 ATGCTTGGACCGGCTGGCTCTGG + Intergenic
1149994569 17:61399960-61399982 GCGCGGGGCCGGGCTGGGCCGGG - Exonic
1152382564 17:79949687-79949709 GGGGTGGGCCGGGCTGGCCCCGG + Intronic
1152463815 17:80454872-80454894 GCGCGCCGCCGCGCTGGCTCCGG - Intergenic
1152809401 17:82374428-82374450 GGGCTCGGTCGGGCTGGCCCAGG - Exonic
1155990261 18:32272579-32272601 ATGCTTGGCTGGGCTGGCCCAGG + Intronic
1157420901 18:47546791-47546813 GTGCTGGGGCGGGCTGGGTCAGG + Intergenic
1160062357 18:75544113-75544135 CCGCTGGGCCGTGCTGCCTCTGG - Intergenic
1160157173 18:76442695-76442717 GCTCTTGGTGGGGCTGGCGCAGG + Exonic
1160592405 18:79951746-79951768 GCGCTGGGCAGGGCGGGCGCAGG + Intergenic
1160909879 19:1469492-1469514 GCGCTCGCCAGGGCTGGGTCGGG - Exonic
1160933511 19:1582146-1582168 GCACTTGGCGGGGCTGGGGCAGG - Intronic
1162372471 19:10287684-10287706 GCGCTTCACCGGCCTGGATCTGG + Exonic
1163020673 19:14479482-14479504 GCGGGTGGCCGCCCTGGCTCTGG - Exonic
1163490909 19:17616746-17616768 GCCCTTGGGCTGGCTGGATCGGG + Intronic
1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG + Exonic
1164061394 19:21678325-21678347 GGGCTGGGCCGGGCAGCCTCAGG + Intergenic
1164169192 19:22709381-22709403 GGGCTGGGCCGGGCAGCCTCAGG + Intergenic
1164222071 19:23203904-23203926 GGGCTGGGCCGGGCAGACTCCGG - Intergenic
1165289828 19:34874196-34874218 GCGCCTGCCCGGGCTGGGGCAGG - Intergenic
1165446132 19:35857512-35857534 ACGCTGGGACGGGCTGGCTAGGG + Intronic
1166652649 19:44586194-44586216 GCCCCTGGCTGGGCTGCCTCTGG + Intergenic
1166980223 19:46627709-46627731 GGGCTTGGCCCGGCTAGCTGGGG - Intergenic
1167558471 19:50210471-50210493 GCGGGTGGCGGGCCTGGCTCGGG + Exonic
1168308910 19:55451236-55451258 GGGCTGGGCCGGGCGGGCGCCGG + Intergenic
926268066 2:11344318-11344340 GGGCTGGGCCGGGCTGGGCCGGG - Exonic
927215875 2:20667530-20667552 GAGCCTGGCCGGGAGGGCTCCGG + Exonic
927427290 2:22995525-22995547 GGGCATGGCTGGGCTGGCTCGGG - Intergenic
930716095 2:54595539-54595561 GAGCTGGGGCGGGCTGGGTCTGG - Intronic
930852939 2:55980993-55981015 GTGCCTGGCCTGGCTGGATCTGG - Intergenic
931441567 2:62293957-62293979 GCGCCTGGCTGGTCTGGCACAGG + Intergenic
932329493 2:70889615-70889637 CCGCCTCGCCGGCCTGGCTCTGG - Intergenic
932694910 2:73947616-73947638 GAGCTAGGCCGTGCAGGCTCCGG + Intronic
932714636 2:74092442-74092464 GGGCTGGGCTGGGCTGGCTGTGG + Intronic
934618688 2:95791180-95791202 GCTCTTTGCCGGGCAGGCTTGGG + Intergenic
934642205 2:96033377-96033399 GCTCTTTGCCGGGCAGGCTTGGG - Intronic
936992984 2:118385872-118385894 CTGCCTGGCCTGGCTGGCTCAGG + Intergenic
938954137 2:136282863-136282885 AGGCTTGCCCGGGCTGGCACTGG - Intergenic
940322261 2:152389916-152389938 GCGGGTGGCCGGGCTGGCCAAGG + Intronic
942618263 2:177817528-177817550 ACGCCTGGCAGAGCTGGCTCAGG + Intronic
944221883 2:197311002-197311024 GCGCCCGGCCGGGCCGGCCCCGG + Intronic
947722530 2:232378594-232378616 GGGCTGGGCCGGGCTGGGGCTGG - Exonic
949037087 2:241820927-241820949 GCCCTTGGCAGGGCCAGCTCCGG - Intergenic
1172109330 20:32536269-32536291 CCGCGGGGCCTGGCTGGCTCAGG - Intronic
1172114127 20:32563582-32563604 GGGCCTGGGCTGGCTGGCTCAGG - Intronic
1173166215 20:40688902-40688924 GCGCTTGGCTCGGCGCGCTCCGG - Exonic
1173522299 20:43709295-43709317 GGGCTGGGCCAGGCTGGCTGTGG - Intronic
1176383712 21:6126690-6126712 GGGCTTGGCCGGGCTGAGCCGGG + Intergenic
1178731450 21:35106749-35106771 GGGCTGGGCTGGGCTGGCTCTGG - Intronic
1179739758 21:43411548-43411570 GGGCTTGGCCGGGCTGAGCCGGG - Intergenic
1179893963 21:44351140-44351162 GGGCTGGGCTGGGCTGGCTGGGG + Intronic
1180077239 21:45468982-45469004 GTTCTTGGCCGGCCTGGCTGGGG + Intronic
1180783529 22:18534792-18534814 GCCCTGGGGAGGGCTGGCTCAGG - Intergenic
1181127096 22:20708843-20708865 GCCCTGGGGAGGGCTGGCTCAGG - Intronic
1181240431 22:21474144-21474166 GCCCTGGGGAGGGCTGGCTCAGG - Intergenic
1181434501 22:22902508-22902530 GAGCTGGGCCAGGCTGGGTCAGG + Intergenic
1182331165 22:29552581-29552603 GCGGCTGGCCGGGCTGGGGCTGG - Intronic
1184523229 22:45007793-45007815 GCGCGCGGCCGGCCGGGCTCTGG + Intronic
1184640485 22:45867626-45867648 GCGCTTGGCCGGACGCGTTCAGG - Intergenic
1184745703 22:46454448-46454470 CTGCCTGGCCGGGCTGGCTGCGG - Intronic
950479916 3:13237867-13237889 GGGCTTGGCTGCTCTGGCTCTGG - Intergenic
954704695 3:52473227-52473249 CTGCTTGGCAGGGCTGGGTCGGG - Intronic
955484925 3:59425720-59425742 GCACTTGGCCGGGCTGGTGAGGG + Intergenic
961236897 3:125375074-125375096 GCGCTCGGCCTGGCAGGCCCGGG - Intronic
961447879 3:126989541-126989563 GGGCACGGCCGGGCCGGCTCAGG - Exonic
961535271 3:127566901-127566923 GGGCTTGCCCGGGCTGGAGCTGG - Intergenic
961567408 3:127773547-127773569 AGGCTGTGCCGGGCTGGCTCTGG + Intronic
961636553 3:128336537-128336559 GCGGGTGGCAGGGCTGGCTGAGG - Intronic
966656492 3:182364393-182364415 GCTGTTGGCAGGGCTGGCACTGG + Intergenic
968213422 3:196868114-196868136 TCGCCTGGCGGGGCTGGCTGGGG + Intronic
968234491 3:197023657-197023679 GAGCGTGGCCCGACTGGCTCAGG - Intronic
968258329 3:197298461-197298483 GCGCCAGGCCGGGAAGGCTCGGG + Exonic
968481220 4:833885-833907 GCGCCTGGCTGGGCCGGCTCGGG - Intergenic
968605589 4:1533666-1533688 ACGCTGGTCCGGGCTGGCTGCGG - Intergenic
969059803 4:4425679-4425701 CAGCTTGGCCGAGCTGCCTCTGG + Intronic
969296556 4:6273545-6273567 GCCCTAGGCCAGGCTGCCTCAGG + Intronic
969521176 4:7678540-7678562 GCGGTTGGCCGGCCTGGGGCAGG + Intronic
985548117 5:520139-520161 GAGCTGGGCAGCGCTGGCTCAGG - Intronic
985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG + Intergenic
985748290 5:1660137-1660159 GCGCTGGGCCAGGCGGGGTCGGG - Intergenic
986740764 5:10703348-10703370 GAGCTGGGCCTGGCTGGCTGTGG + Intronic
992203009 5:74402476-74402498 GCTCCTGGCCAGGCTGGCTATGG - Intergenic
994107411 5:95962114-95962136 GAGATTGGCCAGGCTGGCTTGGG + Intergenic
996039284 5:118792548-118792570 GCCCTTTGCCTGGCTGTCTCTGG - Intergenic
999327403 5:150651594-150651616 GGGCTGGGCTGGGCTGGCTTAGG + Exonic
999410731 5:151347561-151347583 GTGTGTGCCCGGGCTGGCTCTGG + Exonic
1000296401 5:159916621-159916643 GCGCCTGGCCGGGCTCGCGGGGG - Intergenic
1000487601 5:161867426-161867448 GGGGTTAGCAGGGCTGGCTCTGG + Intronic
1001261452 5:170233121-170233143 GCGGTGGGCCGGGCTGGCCTCGG + Exonic
1001617747 5:173056583-173056605 GCTCTGGGCCGGGCCGGCGCGGG + Intronic
1001906713 5:175478940-175478962 GCGCCTGGCCGCGCTGTCTTCGG + Intronic
1002722790 5:181273596-181273618 GCGCTGGTCCGGGCTGCCCCAGG + Intergenic
1005755785 6:28923919-28923941 GCGCTTTGCCCGCCTGGCCCTGG - Exonic
1006357391 6:33567944-33567966 GCGCTCGGCTGCTCTGGCTCGGG - Intergenic
1006398792 6:33803860-33803882 GCCCTGGACCAGGCTGGCTCTGG + Intronic
1006525581 6:34601955-34601977 GCACTTGGCAGGGATGGCTCTGG + Intronic
1012410198 6:98947913-98947935 GCGCTAGGCCGGGCTTGCGGCGG - Exonic
1015366251 6:132401124-132401146 GGGCTCGGCCGGGCGGGCTCCGG + Intronic
1019348720 7:543239-543261 GCCCTCGGCAGGGGTGGCTCCGG - Intergenic
1020101264 7:5395422-5395444 GGGCATGGCGGGGCTGGCTGTGG - Intronic
1023418064 7:39950511-39950533 GCGCTTTTCCCGGCCGGCTCTGG + Exonic
1026817092 7:73521779-73521801 GGGCTGGGCCGGGCTGGGCCGGG - Intronic
1029457706 7:100679396-100679418 CCGCCTGGTCAGGCTGGCTCTGG - Intergenic
1029459232 7:100685923-100685945 GGGCTGGGCCGGGCAGGCACTGG - Intronic
1031483667 7:122305224-122305246 GGGCTGGGCCGGGCTGGGCCGGG + Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1037337059 8:17801572-17801594 GCGCTGTCCCGGGCTGGCGCCGG - Intergenic
1037450661 8:19013587-19013609 GCGCGCGGCCGGGCTGGCGATGG - Exonic
1038138411 8:24815874-24815896 GGGCTTGGCCTGGCTGACCCCGG - Intergenic
1044637400 8:94340908-94340930 GCGGTTGGCCGGGCAGGGGCTGG - Intergenic
1045467602 8:102484798-102484820 GTTCTTGGTCTGGCTGGCTCAGG + Intergenic
1047499576 8:125430979-125431001 GCGTTTGGCCGGGACGCCTCGGG - Exonic
1049208193 8:141373068-141373090 GCGCCTGCCCGGGGTGGCCCAGG + Intergenic
1049351168 8:142165538-142165560 GCCCTGGGCTGGGCTGGCACAGG - Intergenic
1055513073 9:77014202-77014224 GCGCCGGGCCGCGCAGGCTCAGG - Intergenic
1056677297 9:88686338-88686360 GCCCTTCTCCGGGCTGGCTGGGG - Intergenic
1057302027 9:93892116-93892138 GGGCTAGGCTGGGCTGACTCAGG + Intergenic
1059068562 9:111110412-111110434 GCTCTGGGATGGGCTGGCTCTGG - Intergenic
1060151966 9:121294525-121294547 GCACTAGGTGGGGCTGGCTCCGG + Intronic
1061164848 9:128916367-128916389 GTGCTGGGCCGGCCTCGCTCAGG - Exonic
1061628978 9:131859571-131859593 GGGCCTGGCCAGGCTGGCTCTGG + Intergenic
1062235660 9:135506476-135506498 GGGCCTGGCAGAGCTGGCTCAGG + Intergenic
1062443362 9:136583392-136583414 GGGCTGGCCCGGGCTGGCCCAGG + Intergenic
1062574481 9:137200001-137200023 GCGGTTGGCAGGGCCGGCCCGGG + Exonic
1186501022 X:10050599-10050621 GGGCTGGGCTGGGCTGGGTCTGG + Intronic
1190108006 X:47572943-47572965 GGCCTGGGCGGGGCTGGCTCTGG + Exonic
1190873888 X:54446230-54446252 GTGCTTGGCCGGGCGGGCCGAGG - Exonic
1192237100 X:69302902-69302924 GTGCTTGGCAGGCCTGGCTTGGG - Intergenic
1195217057 X:102712732-102712754 GCCCTTGGCCAGGCCCGCTCCGG - Intronic
1195625301 X:107000207-107000229 GCGACTGCCCGGGCTGCCTCTGG + Exonic
1199850384 X:151721697-151721719 GGGCTGGGCCAGGCTGGCTCAGG + Intronic