ID: 985679009

View in Genome Browser
Species Human (GRCh38)
Location 5:1246332-1246354
Sequence GCGCTTGGCCGGGCTGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985679000_985679009 7 Left 985679000 5:1246302-1246324 CCTGGGCGTCCTGCAGCGGCTGA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209
985679002_985679009 -2 Left 985679002 5:1246311-1246333 CCTGCAGCGGCTGAGGTCCCTGC 0: 1
1: 1
2: 0
3: 30
4: 246
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209
985678994_985679009 24 Left 985678994 5:1246285-1246307 CCCTGCTGAGCCCGCGGCCTGGG 0: 1
1: 0
2: 3
3: 33
4: 254
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209
985678996_985679009 23 Left 985678996 5:1246286-1246308 CCTGCTGAGCCCGCGGCCTGGGC 0: 1
1: 0
2: 5
3: 33
4: 306
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209
985678997_985679009 14 Left 985678997 5:1246295-1246317 CCCGCGGCCTGGGCGTCCTGCAG 0: 1
1: 0
2: 2
3: 24
4: 278
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209
985678998_985679009 13 Left 985678998 5:1246296-1246318 CCGCGGCCTGGGCGTCCTGCAGC 0: 1
1: 0
2: 1
3: 25
4: 289
Right 985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG 0: 1
1: 0
2: 0
3: 14
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985679009 Original CRISPR GCGCTTGGCCGGGCTGGCTC AGG Intergenic