ID: 985681240

View in Genome Browser
Species Human (GRCh38)
Location 5:1256989-1257011
Sequence AGAGCTGGGCCCCGATTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985681240_985681254 18 Left 985681240 5:1256989-1257011 CCGTGAAATCGGGGCCCAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 985681254 5:1257030-1257052 CTCGAGGGAAGGGGATTCCTGGG 0: 1
1: 0
2: 29
3: 23
4: 144
985681240_985681253 17 Left 985681240 5:1256989-1257011 CCGTGAAATCGGGGCCCAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 985681253 5:1257029-1257051 CCTCGAGGGAAGGGGATTCCTGG 0: 1
1: 0
2: 0
3: 45
4: 213
985681240_985681247 7 Left 985681240 5:1256989-1257011 CCGTGAAATCGGGGCCCAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 985681247 5:1257019-1257041 CCCACTCCTGCCTCGAGGGAAGG No data
985681240_985681244 2 Left 985681240 5:1256989-1257011 CCGTGAAATCGGGGCCCAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 985681244 5:1257014-1257036 GTTCTCCCACTCCTGCCTCGAGG 0: 1
1: 1
2: 0
3: 19
4: 220
985681240_985681250 9 Left 985681240 5:1256989-1257011 CCGTGAAATCGGGGCCCAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 985681250 5:1257021-1257043 CACTCCTGCCTCGAGGGAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 258
985681240_985681249 8 Left 985681240 5:1256989-1257011 CCGTGAAATCGGGGCCCAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 985681249 5:1257020-1257042 CCACTCCTGCCTCGAGGGAAGGG 0: 1
1: 0
2: 1
3: 8
4: 169
985681240_985681245 3 Left 985681240 5:1256989-1257011 CCGTGAAATCGGGGCCCAGCTCT 0: 1
1: 0
2: 1
3: 9
4: 133
Right 985681245 5:1257015-1257037 TTCTCCCACTCCTGCCTCGAGGG 0: 1
1: 0
2: 0
3: 24
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985681240 Original CRISPR AGAGCTGGGCCCCGATTTCA CGG (reversed) Intronic
900432678 1:2610487-2610509 GGAGCTGGGCCCGGCTTACAGGG - Intronic
901334626 1:8438606-8438628 AGAGCTGGGCTCTGATTCAAAGG + Intronic
901658881 1:10786435-10786457 GGAGCTGGGCCCCTAGTGCAGGG - Intronic
903932347 1:26870041-26870063 AGAGCTGGGCCTCCATTTTCTGG - Intergenic
904243399 1:29166747-29166769 AGAGCTGGGGTGCGACTTCAGGG + Intronic
904983269 1:34524356-34524378 AGAGCAGGGGCCAGATCTCACGG + Intergenic
905111020 1:35594713-35594735 AGAGCTAAGTCCCTATTTCAGGG - Exonic
910916933 1:92299178-92299200 AGATCGGGGCCCAGCTTTCAGGG - Intronic
912799309 1:112711229-112711251 AGAGCTGGGGCCCGTTCCCATGG - Intronic
913164543 1:116172788-116172810 AAACCTGGGCCCCAATGTCAGGG + Intergenic
913525605 1:119689653-119689675 AGAGCTGGGACTTGAGTTCAGGG - Intronic
920065931 1:203269730-203269752 TGAGCTGCGGCCTGATTTCATGG + Intronic
924206301 1:241714538-241714560 ACAGCTGAGCTCCTATTTCATGG + Intronic
1065022173 10:21509809-21509831 AGAGCTGGGCCCCATTTGCCTGG + Intergenic
1065738591 10:28776089-28776111 ATTGCCGGGCCCCAATTTCAAGG + Intergenic
1065857430 10:29841784-29841806 AGAGCTGGGCCCCCAAGTTAGGG - Intergenic
1071728210 10:88220664-88220686 AGAGCTGGGACCAGAACTCAGGG + Intergenic
1072448191 10:95517576-95517598 AGACCTGAGCCCTGACTTCATGG - Intronic
1073247630 10:102102718-102102740 AGAGCTGGGCCCTGAGTGAATGG + Intergenic
1077555866 11:3225755-3225777 CGAGCTGGGCCCAGTTTCCATGG + Intergenic
1079383319 11:19957947-19957969 AGGGTTGGGCCTCGATTTCTTGG + Intronic
1080646006 11:34188187-34188209 AGAGCCGGGACCCCATATCATGG + Intronic
1081366539 11:42242154-42242176 AGAGCTGGTCCCAGACTTCACGG + Intergenic
1081742966 11:45453828-45453850 AGAGCAGGGCCCAGAATCCAGGG + Intergenic
1082997501 11:59265441-59265463 AGAGCTGGGCCTCAAATTCCAGG - Intergenic
1083014694 11:59440988-59441010 AGAAATGGGCCCCAATTTCAAGG + Intergenic
1083295293 11:61712109-61712131 GGAGCTGGGCACAGAGTTCAGGG - Intronic
1085118255 11:73949504-73949526 AGAGCTGGGCCCTGATTATGAGG + Intergenic
1090377548 11:126301964-126301986 AGTGTTGGGGCCCGACTTCATGG + Intronic
1091776350 12:3187433-3187455 AGTGCTGGGCCCTGCTTTTATGG - Intronic
1092515946 12:9212394-9212416 GGAGCTGGTACCAGATTTCAAGG + Intergenic
1093207385 12:16267320-16267342 ATACTTGGGCACCGATTTCATGG + Intronic
1108932444 13:55843394-55843416 AGAGCTGGACCCAGCTTTCCAGG + Intergenic
1109175070 13:59145076-59145098 GGAGCTGTGCCCAGATGTCAGGG + Intergenic
1110133810 13:72040713-72040735 AAACCTGGGCCCCTATCTCAGGG + Intergenic
1110192916 13:72751969-72751991 AGTGCTGGGCCCAGATGTCAAGG + Intronic
1110328941 13:74249425-74249447 AGAGCTGGGCCCCGGTGCCTTGG + Intergenic
1114263189 14:21053953-21053975 AGAGGTGGGACCAGAATTCAGGG + Intronic
1114267747 14:21082586-21082608 AGGGCTGGGCCCCAAGGTCATGG - Intronic
1119945930 14:78694119-78694141 AGAGCTCATCCCTGATTTCATGG + Intronic
1121144847 14:91574548-91574570 AGAGCTGGGTCTGGATTGCATGG + Intergenic
1122233029 14:100316581-100316603 AGAGCTGGGCCTCAAATTCCAGG + Intergenic
1126790182 15:52213853-52213875 AGACCTGGGCCCTGCTCTCATGG + Intronic
1127820034 15:62646757-62646779 GGAGCTGGGCCCAGAATCCAAGG + Intronic
1129524708 15:76206415-76206437 AGACTTGGGCCCCAGTTTCAGGG - Intronic
1130053119 15:80500277-80500299 AGTTCTGGGCCCCCATTTCAGGG + Intronic
1130212999 15:81943600-81943622 AGAGAAGGGCCCCAATGTCAGGG - Intergenic
1132141826 15:99403301-99403323 AGAGCTGGGCCCTGCCTTCAGGG + Intergenic
1133446477 16:5865409-5865431 ATGGCTGGGCCCCGGATTCATGG + Intergenic
1136014666 16:27388370-27388392 AGAACTTGGCCCTGATATCATGG - Intergenic
1136317100 16:29460783-29460805 AGCGCGGGGCCCAGATATCAGGG - Intronic
1136431675 16:30200125-30200147 AGCGCGGGGCCCAGATATCAGGG - Intronic
1137387557 16:48055519-48055541 AGAGCTGGGCCCTGGTTTCACGG - Intergenic
1138829979 16:60363643-60363665 GGAACTGGGCGCCCATTTCAGGG - Intergenic
1141157364 16:81606666-81606688 AGACCTAGGCCCTGACTTCATGG + Intronic
1142012252 16:87721560-87721582 AGAGCTGGGCACGGACCTCAGGG + Intronic
1145250702 17:21295522-21295544 AGAGCTGGGCCCAGATGGCCAGG - Intronic
1146058998 17:29594673-29594695 AGAGCTGGGCCCGGGTCCCATGG + Intronic
1147900045 17:43778256-43778278 GGAGCTGGGCCGGGATTTCCAGG - Intronic
1148119880 17:45202245-45202267 AAAGCTGGGTCCCAATTTCTGGG + Intergenic
1149139114 17:53408470-53408492 ATTGCTGGGCCCTGATTGCAAGG + Intergenic
1152420623 17:80190996-80191018 GCAGCTGGTCCCAGATTTCAGGG + Intronic
1153317630 18:3740583-3740605 AGAGCAGTGTCCCTATTTCAGGG + Intronic
1153469903 18:5432374-5432396 AGAGTTAGTCACCGATTTCATGG - Intronic
1154009970 18:10565769-10565791 AGAGATGGGCCCCTGTTTCCAGG - Intergenic
1156601278 18:38610122-38610144 ACAGCTGGGGCCCTACTTCACGG - Intergenic
1156724434 18:40111059-40111081 AGAGCTGTGTCTCAATTTCAGGG + Intergenic
1161659316 19:5536358-5536380 AGAGCAGGGCCTTGATCTCAAGG + Intergenic
1161765779 19:6207801-6207823 AGAGCTGGGGCCCTACCTCATGG + Intergenic
1162746961 19:12804195-12804217 AGCGCCGGGCCCGGTTTTCATGG + Intronic
1163404513 19:17113793-17113815 GGAGCTGGGGCCCGAATGCAGGG + Intronic
1165423217 19:35732462-35732484 AGACCTGGGCCCAGACTTCGAGG + Exonic
1166377024 19:42333459-42333481 AGACCTGGGCCCCGCCTTGAAGG - Intronic
1166878916 19:45914924-45914946 AGAGCTGGGACCAGAGATCAGGG - Intergenic
1167071867 19:47226605-47226627 GCAGCTGGGCCCCGATCTCCCGG + Exonic
1167148305 19:47695231-47695253 AGGGCTGGCCCCAGATTTGAAGG + Intronic
1168556911 19:57351152-57351174 TGAGCTGGGCACAGATTTCTGGG - Intergenic
926009364 2:9396092-9396114 AGAGCTGGGGCGAGATTCCAGGG + Intronic
926663014 2:15489375-15489397 AGATCTGGGCCCAAATTTTAAGG - Intronic
927453807 2:23232092-23232114 GGAGATGGGCCCAGAGTTCAGGG + Intergenic
932413842 2:71562225-71562247 AGAGCTGGGACCAGAATCCAAGG + Intronic
936556039 2:113499505-113499527 AGAGTTTGGCACCGAGTTCAGGG + Exonic
937260098 2:120579943-120579965 GGAGCTGGACCAAGATTTCATGG - Intergenic
938256723 2:129865046-129865068 AGAGCAGGGACCCCATTTTAGGG - Intergenic
938954869 2:136288170-136288192 AGTGCTGGGCGCTGAGTTCAAGG - Intergenic
944416850 2:199487579-199487601 AGAGCTGGTCCCTATTTTCAGGG - Intergenic
946812240 2:223538228-223538250 AGACCTTGGCCCCTGTTTCATGG + Intergenic
1172097293 20:32466673-32466695 AGAGCTGGGCCCCATTCTCTGGG - Intronic
1172361317 20:34314613-34314635 AGACCTGGGCCCTGCTCTCAAGG + Intergenic
1173737938 20:45374959-45374981 AGAGCTGGGCCCCAGAGTCAGGG - Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1175547080 20:59785318-59785340 AGAGCGGGGCCCTGATCTGATGG - Intronic
1175973338 20:62698319-62698341 AGAGCTGGGCCCAGCCTTCGGGG + Intergenic
1176645501 21:9345452-9345474 AGGACTGGGCGCCGTTTTCAGGG - Intergenic
1179061810 21:37986078-37986100 AGAGCTGAGCCCCTCTTTTAAGG - Intronic
1179835340 21:44028302-44028324 AGAGCTCTGCCCCGCTTTCCCGG + Intronic
1183537859 22:38413540-38413562 AGAGCGGGACCCTGATTCCAGGG + Intergenic
1184648073 22:45906920-45906942 GGAGCTGGGCACTGATATCAAGG + Intergenic
1184686418 22:46098359-46098381 TGAGCTGGGCCCAGGTCTCATGG + Intronic
1184832395 22:46996999-46997021 AGAGCTGGGGCCCCATTCCTGGG + Intronic
951987609 3:28638373-28638395 AGAACTGGGCCCAGCTTTCATGG + Intergenic
953778595 3:45844701-45844723 AGAGAAGGGCCCAGATTACAGGG + Intronic
955330559 3:58043769-58043791 AGAGCTGGGCACATAATTCAAGG - Intronic
955861303 3:63333354-63333376 AGAGAAGAGCCCCAATTTCAAGG + Intronic
956456042 3:69421235-69421257 AGAGCTGGCACCAGAATTCAAGG - Intronic
960902100 3:122563827-122563849 AGAGCAAGGCCCTGATGTCAAGG - Intronic
962828827 3:139122049-139122071 GGAGCTGGGCCCTGATGTCAGGG - Intronic
1202741387 3_GL000221v1_random:59616-59638 AGGACTGGGCGCCGTTTTCAGGG + Intergenic
969210621 4:5684537-5684559 AGATGTGGTCCCCGACTTCAAGG - Intronic
971189916 4:24417449-24417471 AGAACTTGGACCAGATTTCAGGG - Intergenic
982220751 4:153123235-153123257 AAAGCTAGGCCCGGATTGCAAGG + Intergenic
985681240 5:1256989-1257011 AGAGCTGGGCCCCGATTTCACGG - Intronic
987037999 5:14037231-14037253 AGCGCGGGGCCCAGATCTCATGG - Intergenic
988604578 5:32668579-32668601 TGAGCTGGGCCCCTCTGTCATGG + Intergenic
999152483 5:149435504-149435526 AGAGCTGGGCACAGAGTTAAGGG - Intergenic
1005246485 6:23891592-23891614 AGAGCTGTGTCCCTCTTTCAGGG + Intergenic
1005788521 6:29272299-29272321 AGAGTGGGGCCCCCATGTCAGGG - Intergenic
1010196389 6:73243664-73243686 AGAGTTGGGGCATGATTTCATGG - Intronic
1012976021 6:105781677-105781699 AGACCTGGACCCAGGTTTCAAGG + Intergenic
1015560944 6:134515256-134515278 AGAGCTGGACCTCCATTTCCAGG + Intergenic
1019200155 6:170307311-170307333 AGAGCTGGGGCCCTGATTCAGGG - Intronic
1019757879 7:2786972-2786994 AGAGCTGAACCCCGTGTTCATGG - Intronic
1024267002 7:47614519-47614541 AGAGCTGGGCCCCGAGCTTGTGG + Intergenic
1024505086 7:50155994-50156016 CGTGCTGGGCCCAGATGTCAAGG + Intronic
1025994407 7:66518894-66518916 GGAGCTGGCCCCCAACTTCAGGG + Intergenic
1026033591 7:66815769-66815791 GGAGCTGGCCCCCAACTTCAGGG - Intergenic
1026986018 7:74555583-74555605 GGAGCTGGCCCCCAACTTCAGGG + Intronic
1030364933 7:108634989-108635011 AGACCTAGTCCCCGATTTCATGG - Intergenic
1035367321 7:158357687-158357709 AGAGCTGGGTCCCGGTTGCTTGG - Intronic
1044155667 8:88843396-88843418 AGAGCTAAGCCCCAATTTCAGGG - Intergenic
1045353069 8:101360267-101360289 AGAGCTGAGCTCTGCTTTCAGGG + Intergenic
1049759894 8:144327155-144327177 TGCGCTGGGCCCCGACTTCCTGG + Intergenic
1049896989 9:117858-117880 AGAGTTTGGCACCGAGTTCAGGG - Exonic
1053605857 9:39658221-39658243 ACAGCTGGGGCCCAATCTCAAGG - Intergenic
1053863774 9:42414845-42414867 ACAGCTGGGGCCCAATCTCAAGG - Intergenic
1054247688 9:62684195-62684217 ACAGCTGGGGCCCAATCTCAAGG + Intergenic
1054561804 9:66718720-66718742 ACAGCTGGGGCCCAATCTCAAGG + Intergenic
1059858656 9:118431783-118431805 AGAGATGGACCCTGTTTTCAAGG + Intergenic
1061101617 9:128496602-128496624 AGAGCTGGGCCCCAAGGCCAGGG - Intronic
1061191168 9:129083560-129083582 AGGGCTGAGCCCAGATTCCAGGG - Intronic
1203710025 Un_KI270742v1:89540-89562 AGGACTGGGCACCGTTTTCAGGG + Intergenic
1194683701 X:96884970-96884992 AGAGCTGAGCCCGGAGCTCATGG - Exonic
1196373960 X:115011017-115011039 AGACATAGTCCCCGATTTCATGG + Intronic
1198304210 X:135364714-135364736 GGGGCTGGGCCCAGATTTAAGGG - Intergenic