ID: 985681782

View in Genome Browser
Species Human (GRCh38)
Location 5:1259474-1259496
Sequence GAGTGGACGCGGACGCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 2, 1: 9, 2: 9, 3: 9, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985681774_985681782 19 Left 985681774 5:1259432-1259454 CCACAGGAGAGAGGGAGCGGACG 0: 1
1: 3
2: 5
3: 24
4: 160
Right 985681782 5:1259474-1259496 GAGTGGACGCGGACGCCCACAGG 0: 2
1: 9
2: 9
3: 9
4: 49
985681773_985681782 20 Left 985681773 5:1259431-1259453 CCCACAGGAGAGAGGGAGCGGAC 0: 1
1: 3
2: 9
3: 15
4: 180
Right 985681782 5:1259474-1259496 GAGTGGACGCGGACGCCCACAGG 0: 2
1: 9
2: 9
3: 9
4: 49
985681779_985681782 -10 Left 985681779 5:1259461-1259483 CCCACAGGAGAGGGAGTGGACGC No data
Right 985681782 5:1259474-1259496 GAGTGGACGCGGACGCCCACAGG 0: 2
1: 9
2: 9
3: 9
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985681782 Original CRISPR GAGTGGACGCGGACGCCCAC AGG Intronic