ID: 985684033

View in Genome Browser
Species Human (GRCh38)
Location 5:1272366-1272388
Sequence GGACCTGCGGCCAAGCCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
985684028_985684033 15 Left 985684028 5:1272328-1272350 CCAGAGCTGGGCACTTGTTTCTT 0: 1
1: 0
2: 1
3: 15
4: 222
Right 985684033 5:1272366-1272388 GGACCTGCGGCCAAGCCCGATGG 0: 1
1: 0
2: 1
3: 7
4: 97
985684025_985684033 21 Left 985684025 5:1272322-1272344 CCCCGGCCAGAGCTGGGCACTTG 0: 1
1: 0
2: 3
3: 16
4: 238
Right 985684033 5:1272366-1272388 GGACCTGCGGCCAAGCCCGATGG 0: 1
1: 0
2: 1
3: 7
4: 97
985684024_985684033 25 Left 985684024 5:1272318-1272340 CCTGCCCCGGCCAGAGCTGGGCA 0: 1
1: 0
2: 3
3: 51
4: 533
Right 985684033 5:1272366-1272388 GGACCTGCGGCCAAGCCCGATGG 0: 1
1: 0
2: 1
3: 7
4: 97
985684031_985684033 -8 Left 985684031 5:1272351-1272373 CCGATCAGGACGTGTGGACCTGC 0: 1
1: 0
2: 0
3: 6
4: 58
Right 985684033 5:1272366-1272388 GGACCTGCGGCCAAGCCCGATGG 0: 1
1: 0
2: 1
3: 7
4: 97
985684026_985684033 20 Left 985684026 5:1272323-1272345 CCCGGCCAGAGCTGGGCACTTGT 0: 1
1: 1
2: 0
3: 34
4: 285
Right 985684033 5:1272366-1272388 GGACCTGCGGCCAAGCCCGATGG 0: 1
1: 0
2: 1
3: 7
4: 97
985684027_985684033 19 Left 985684027 5:1272324-1272346 CCGGCCAGAGCTGGGCACTTGTT 0: 1
1: 0
2: 2
3: 16
4: 189
Right 985684033 5:1272366-1272388 GGACCTGCGGCCAAGCCCGATGG 0: 1
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985684033 Original CRISPR GGACCTGCGGCCAAGCCCGA TGG Intronic
901400333 1:9011215-9011237 GGGCCTGCGGGGAAGCCCCAGGG - Intronic
903324773 1:22563577-22563599 GCCGCAGCGGCCAAGCCCGAGGG + Exonic
903848911 1:26294725-26294747 GGACATGCGGCCAAGCCCTAGGG - Intronic
912497051 1:110098451-110098473 GGACCTGGGGCCAAGGGCGGAGG - Intergenic
913648637 1:120887732-120887754 GGACTTGGGGCCAGGCCTGATGG + Intergenic
914078059 1:144375630-144375652 GGACTTGGGGCCAGGCCTGATGG - Intergenic
914101120 1:144590871-144590893 GGACTTGGGGCCAGGCCTGATGG + Intergenic
914172968 1:145244164-145244186 GGACTTGGGGCCAGGCCTGATGG - Intergenic
914527618 1:148485301-148485323 GGACTTGGGGCCAGGCCTGATGG - Intergenic
914638772 1:149581760-149581782 GGACTTGGGGCCAGGCCTGATGG + Intergenic
915554721 1:156655003-156655025 GGACCTGTGGCCAGGCCAGCGGG + Intronic
915828714 1:159105359-159105381 GGAGCTGCGGCCCAGACCAAGGG - Intronic
1063269085 10:4486845-4486867 AGACCTCTGGCCAAGCCTGATGG + Intergenic
1071328062 10:84535923-84535945 AGACCTGGGGCCATGCCCCATGG - Intergenic
1071428190 10:85580711-85580733 AGAACTGCCGCCAAGCCCCACGG + Intergenic
1073641264 10:105254899-105254921 GGATCTGCGGCCAGGCGCGGTGG + Intronic
1075428678 10:122362853-122362875 GGCCCTGAGGCCAACCCCGCTGG - Intergenic
1076692738 10:132232067-132232089 GCACCTGCGGCCACGCCTGCAGG + Intronic
1077014673 11:394281-394303 GGACCTGCCGCCATGCAGGACGG + Exonic
1077144811 11:1040102-1040124 GGACCAGCTGCCAAGCCTCAGGG - Intergenic
1083192653 11:61063418-61063440 GGAGATGGGGCCAAGCCCCATGG + Intergenic
1088720074 11:112584592-112584614 GGAGCTGAGGTCAAGCCCAAGGG + Intergenic
1092192328 12:6529932-6529954 CGACGTGGGGCCAAGCCTGAGGG + Exonic
1092927965 12:13289290-13289312 GGACCTGCTGCCAAGAATGAAGG + Intergenic
1103137655 12:118521521-118521543 GAACCTGCGGCCAGGCACGGTGG - Intergenic
1103602893 12:122065293-122065315 GGGTCTGCGGCCAAGCCTGTGGG + Intergenic
1103604702 12:122078398-122078420 GGGCCTGCGGCGAAGCCACAGGG + Intergenic
1129785000 15:78304160-78304182 GGGCTTGGGGCCAAGCCCCAGGG + Intergenic
1130569622 15:85029935-85029957 GGACCTGAGGGGAAGCCCGCTGG - Intronic
1130804108 15:87300638-87300660 GGTCCTTAGGCCAAGCCAGATGG - Intergenic
1132384108 15:101387742-101387764 GGAACTGGGGCAAAGCCAGATGG - Intronic
1132870059 16:2111971-2111993 GCACCTGCGGCCCAGCCTTAAGG + Intronic
1133029205 16:3001627-3001649 GCACCAGAGGCCAAGCCCAAGGG - Intergenic
1133292924 16:4734595-4734617 GTACCTGCGGCGCGGCCCGAGGG + Exonic
1134710150 16:16323630-16323652 GCACCTGCGGCCCAGCCTTAAGG - Intergenic
1134717364 16:16363630-16363652 GCACCTGCGGCCCAGCCTTAAGG - Intergenic
1134949453 16:18345015-18345037 GCACCTGCGGCCCAGCCTTAAGG + Intergenic
1134957388 16:18388529-18388551 GCACCTGCGGCCCAGCCTTAAGG + Intergenic
1136185440 16:28585761-28585783 GGACCTGCAGCCCAGCCCCCAGG - Intronic
1136369172 16:29825297-29825319 GGAGCAGGGGCCAAGCCTGAGGG + Intronic
1141692778 16:85606029-85606051 GGGCTGGCGGCCAAGCCCGATGG - Intergenic
1147411678 17:40257523-40257545 GAACCTGAGGCCAGGCGCGATGG + Intronic
1151354969 17:73553000-73553022 GGAGCTGCAGCCAATCCCAAAGG - Intronic
1152288273 17:79424718-79424740 GGAGCTCCGGCCCGGCCCGAGGG - Intronic
1152718381 17:81910849-81910871 GGACCCGCGGTGAAGCCCGCGGG - Intronic
1152758723 17:82097741-82097763 GGAGCCGAGGCCCAGCCCGAAGG - Intronic
1152868500 17:82738024-82738046 GGACCTGAGGCCCCGCCTGATGG + Intronic
1152907709 17:82977970-82977992 GAACCTCCAGCCAAGCCCCAGGG - Intronic
1160527081 18:79544421-79544443 GGCCCTGAGGCCAAGCCCAGGGG + Intergenic
1160930570 19:1567946-1567968 GGACCTGCGCCCCCGCCCGAGGG - Exonic
1161486101 19:4536741-4536763 GGACATGCCCCCAAGCCCCAGGG + Exonic
1163262092 19:16197616-16197638 CGACCTGGGGCCCAGCCCTATGG - Intronic
1166369452 19:42292990-42293012 GGCCCAGCGGCCCAGCCCGAAGG + Exonic
1166391624 19:42411728-42411750 GGACCAGTGGACAAGCCTGAAGG - Intronic
1167611821 19:50511371-50511393 GGACCTGCCGCGGAGCCCGACGG - Intergenic
1168137460 19:54360853-54360875 GGACCTGGGGACAAGCTCGAGGG + Intronic
1168160617 19:54508225-54508247 GGACCTCGGGACAAGCTCGAGGG - Intronic
929983160 2:46699395-46699417 GCACCTGCGGCCAGGCAGGACGG - Intronic
932098396 2:68873117-68873139 GGCCCTGCGGACAAGCCCAGGGG + Intergenic
937289324 2:120772573-120772595 GGGCCTATGGCCAGGCCCGAAGG - Intronic
946351102 2:219153550-219153572 AGACCTGGGGCCAAGCACGGAGG + Intronic
947118509 2:226795885-226795907 GGACCTGGGGCCGGGCCGGAGGG - Exonic
947836701 2:233180959-233180981 GGACCTGAGGCCAAGCACGGTGG - Intronic
1169123084 20:3109044-3109066 GGACCCGCGGCTAAGCTCAAGGG + Exonic
1169132618 20:3173802-3173824 GGGCCTGAGCCCAAGCCCAAGGG - Intergenic
1169843522 20:9965439-9965461 GGACCTGAGGCCAGGCGCGGTGG + Intergenic
1170795345 20:19542059-19542081 GGACCTGCAGCCAGGCTGGAAGG + Intronic
1175947324 20:62565011-62565033 GGACCTGCGGCCGGGCCGCACGG - Exonic
1183720529 22:39559224-39559246 GGATCTGTGGCCCAGCCCCAGGG + Intergenic
1183913035 22:41092768-41092790 GGGCCTGGGCCCAAGCCCGGAGG - Exonic
1184754109 22:46506802-46506824 GAAGCTGAGGCCAAGCCCGGGGG + Intronic
958736024 3:98010524-98010546 GGTCCGGGGGCCAAGCCAGATGG - Intronic
961104257 3:124227852-124227874 GGTCCTACAGCCCAGCCCGATGG - Intronic
961602422 3:128072106-128072128 CGACCTGTAGCCAAGCCAGAAGG + Intronic
963864033 3:150340913-150340935 GGACCTGCGGCCGGGCGCGGTGG - Intergenic
968939068 4:3628621-3628643 GGACCCCCCGCCAAGCCCGTTGG - Intergenic
978630598 4:110739390-110739412 GGACCTACGGCAAAGCTCAAAGG - Intergenic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
985684033 5:1272366-1272388 GGACCTGCGGCCAAGCCCGATGG + Intronic
985826285 5:2193975-2193997 GGACCTGCTGCCAGGCCACAAGG + Intergenic
995182905 5:109245467-109245489 GGACCTGCTGCCAAGCCATGGGG + Intergenic
1000368482 5:160512408-160512430 GGGCCTGGGGCCAAGCATGAAGG - Intergenic
1004868670 6:19880271-19880293 GGACCTTCTGTCAAGCACGAGGG + Intergenic
1013735484 6:113222099-113222121 GCACCTGCGGCCAGGCAAGACGG - Intergenic
1014127516 6:117794120-117794142 GCAGCTGAGGCCAAGCCTGAAGG - Intergenic
1019776324 7:2913843-2913865 GGACCAGCGGCCAAGGCCTTGGG + Intronic
1024983145 7:55174063-55174085 GGCCCTGCGGCCCAGCCCAGAGG - Intronic
1026129210 7:67606473-67606495 GGTCCTGTGGCCAGGCCCGGGGG + Intergenic
1028121444 7:87059789-87059811 GGGGCTGCGGCCCAGCCCGGCGG + Intergenic
1028653933 7:93181112-93181134 GGAACTGCGGCCAAGACGGAAGG - Intergenic
1029176745 7:98670038-98670060 GAACCTGCCGCCAAGCCCCTGGG + Intergenic
1038311281 8:26448344-26448366 GTCCCTGCGTCGAAGCCCGAGGG - Intronic
1041271991 8:56117883-56117905 GCACCAGCGGGCGAGCCCGAGGG - Intergenic
1049154776 8:141059787-141059809 GGACCTGCCGCCCAGCCCTCCGG - Intergenic
1050475336 9:6034821-6034843 GTACCTGCGGGCAAGGCAGATGG - Intergenic
1053200354 9:36147958-36147980 GGCCCTGTGGCCAGGCACGATGG + Intronic
1056874977 9:90319360-90319382 GGACCTGTGGCAAAGCCGCATGG - Intergenic
1057152632 9:92808670-92808692 GTAGCTGCGGCCAAGCCAGGCGG + Intergenic
1057152715 9:92808987-92809009 GTGGCTGCGGCCAAGCCCGGCGG + Intergenic
1060554326 9:124500493-124500515 GGACCGGCGGCCAGGCCCTTGGG + Exonic
1061935251 9:133853833-133853855 GAACCTGCAACCAAGCCCCAGGG + Intronic
1062207860 9:135347138-135347160 GGACCTGGGGGCAAGACCGGTGG - Intergenic
1189819748 X:44858711-44858733 GAACCTGGGGCCAGGCGCGATGG - Intergenic
1196456524 X:115895225-115895247 TCTCCTGAGGCCAAGCCCGATGG + Intergenic
1199981793 X:152924967-152924989 GCACCTGAGGCCAAGCGCGGTGG - Intronic
1201475668 Y:14378270-14378292 TGACCTACGGCCAACCCAGATGG - Intergenic