ID: 985684082

View in Genome Browser
Species Human (GRCh38)
Location 5:1272594-1272616
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 12, 1: 0, 2: 2, 3: 22, 4: 276}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
985684082 Original CRISPR TCTGATGTGGTGACTGTGGA TGG (reversed) Intronic
902404556 1:16175637-16175659 CCTGAGGTGGGGACTGTGGAGGG - Intergenic
903029031 1:20449425-20449447 TCTGAAGTGGTGATATTGGAAGG - Intergenic
905787313 1:40768686-40768708 TCTTATGTGTGGACTGTGAATGG - Intronic
907367194 1:53971788-53971810 TCTGAAGGGGTAAATGTGGAAGG - Intergenic
910724904 1:90328155-90328177 TCGGCTGTGGTGGCTGTGGAGGG + Intergenic
910911455 1:92238765-92238787 TCTTATATGGTGAGTGTGTAAGG - Intronic
912055477 1:105592925-105592947 ACTGAAGTGGGGGCTGTGGATGG - Intergenic
912799740 1:112713543-112713565 TGTGAAGTGGTGTATGTGGAAGG - Exonic
915783204 1:158577760-158577782 CCTGATATAGTGACTGTGGCGGG - Intergenic
915795043 1:158721245-158721267 TCTCATGTCGTGAGTGTGTATGG + Intergenic
917247322 1:173018380-173018402 TCTGCTTTAGTGATTGTGGAAGG + Intergenic
917835703 1:178939811-178939833 CCTGTTGTGGTGACTCTGAATGG + Intergenic
918384554 1:183992727-183992749 TTTCATCTGGTGACTTTGGAAGG + Intronic
919617018 1:199820547-199820569 ACCGATGTGGTCACAGTGGAAGG + Intergenic
919801005 1:201354628-201354650 TGTGATCTGGGGACTGTGGATGG + Intergenic
922284623 1:224158750-224158772 TCAGATGTGGTGAGTGAGTAGGG + Exonic
1063386785 10:5620794-5620816 TGGGATGTGGTGGCTGTGGAAGG - Intergenic
1065161482 10:22927506-22927528 GCTGAAGTGATGACTGTGGTTGG + Intergenic
1065341551 10:24711443-24711465 TCTGACGTGGGGACTGAAGATGG - Intronic
1066672469 10:37854964-37854986 TCTGATTTAGTAGCTGTGGATGG - Intronic
1067180189 10:43979547-43979569 CCTGAAATGGTGACTGTGGTAGG + Intergenic
1067310787 10:45111707-45111729 TGTGTTGTGGTGTGTGTGGAGGG + Intergenic
1072807734 10:98435290-98435312 TTTGGGCTGGTGACTGTGGACGG - Exonic
1073023284 10:100465571-100465593 TCTGATTTGGTGACTGAGTTAGG - Intronic
1073153711 10:101329669-101329691 TCTGGGGTGGTGTGTGTGGAGGG - Intergenic
1074163740 10:110856995-110857017 TCTGGTCTGGGGACTGTGGTGGG + Intergenic
1076130980 10:128013738-128013760 GCGGATGTGGTGTCTGGGGAGGG - Intronic
1076620397 10:131783652-131783674 TCTGACAGGTTGACTGTGGAGGG - Intergenic
1077365370 11:2159375-2159397 TCTGATGGAGTCCCTGTGGAGGG - Intronic
1077475424 11:2788069-2788091 TAGAATGTGGTGAATGTGGATGG + Intronic
1078418184 11:11182974-11182996 TCAGCTGTGGTGACTGAGGCTGG + Intergenic
1078747216 11:14127005-14127027 TCTGATTGGGTGATTGGGGAGGG - Intronic
1078992530 11:16664466-16664488 TCTCAGCTGGTGCCTGTGGAGGG + Intronic
1079173143 11:18115210-18115232 TAGGATGTGGTGCCTTTGGAAGG - Intronic
1080633642 11:34104683-34104705 TCTGACGGGGTGACACTGGATGG - Intergenic
1082861661 11:57862853-57862875 TCAGATGTGGAGACACTGGATGG + Intergenic
1083619424 11:64041638-64041660 GCTGGTGTGGTGGCAGTGGAGGG + Intronic
1083759545 11:64808087-64808109 TCCAATTTGGTGCCTGTGGAAGG + Exonic
1084600817 11:70144441-70144463 TCAGATGTGGAGACTGAGGTTGG + Intronic
1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG + Intronic
1089793717 11:120963427-120963449 GCTGCTGTGGTGATTGTGAAGGG + Intronic
1090373272 11:126271541-126271563 TCGGATGTGGTGATCGTGGGAGG + Exonic
1090978553 11:131696214-131696236 TGTCACGTGATGACTGTGGAAGG + Intronic
1091323709 11:134668918-134668940 TCTGATGTGCTGCCTGGGGCTGG + Intergenic
1092650325 12:10627705-10627727 TAGGATGTGATGACTATGGATGG - Exonic
1093367932 12:18326303-18326325 TATGATGTGTTATCTGTGGAAGG - Intronic
1093890335 12:24512384-24512406 TCTGTTCTGGTGACAATGGAAGG - Intergenic
1093949439 12:25147718-25147740 TCTGATGTTATGACTGAGAAAGG - Intronic
1096409966 12:51369796-51369818 GCAGATGTGCTGATTGTGGAAGG - Intronic
1096859761 12:54516824-54516846 TCTTCTGTGCTGCCTGTGGAGGG + Intronic
1097285916 12:57877162-57877184 GGTGATGTGGAGTCTGTGGAGGG + Intergenic
1098240741 12:68464296-68464318 TCTAATGAGGTGACTTTGGGAGG - Intergenic
1103219519 12:119232097-119232119 TCAGGTGAGGTGAGTGTGGAAGG - Intergenic
1103281401 12:119760747-119760769 ACTGAGGTGGTGGCTCTGGATGG - Intronic
1103606952 12:122093996-122094018 TCTGGTGTGGTGTGTGTGCAGGG + Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105984680 13:25553783-25553805 TCTGAGGTGGTGTCTGTGGAAGG - Exonic
1106022219 13:25926317-25926339 GTTGATGTGGTGACAGGGGAGGG - Intronic
1106933467 13:34692455-34692477 GCTGATGTGGTGTCTGATGAGGG + Intergenic
1107781494 13:43908041-43908063 TCTGATGTTGTGACTCTTCAAGG + Intergenic
1109654943 13:65377794-65377816 TCTGATTTTGTCAGTGTGGAGGG - Intergenic
1110531366 13:76602531-76602553 TCTGATGGGGGGACGCTGGAAGG - Intergenic
1111678774 13:91418582-91418604 AGTGATGGGGTGAGTGTGGAAGG + Intronic
1114661272 14:24346724-24346746 TCTGAGGGAGTGACTGAGGAAGG + Intergenic
1115356183 14:32450277-32450299 GCTGATTTTGTGACTGTGGTAGG + Intronic
1115795758 14:36933646-36933668 TCTGATGTGGAGGCTGGTGAAGG - Intronic
1117101732 14:52355637-52355659 TCCGATGAGGTGAATGTTGAGGG - Intergenic
1117129137 14:52667110-52667132 ACTGCTGTGGTTAATGTGGAGGG - Intronic
1122103063 14:99428850-99428872 TCTGAAGGTGTGACTGGGGAAGG - Intronic
1122757668 14:103995467-103995489 TCTGGTGTGGTAACTTTGGTGGG - Intronic
1124208158 15:27740822-27740844 TCAGATCTGCTGACTGTGTAGGG - Intergenic
1125115609 15:36087627-36087649 CCTGATGTGATCACTGTGCATGG + Intergenic
1125541655 15:40473017-40473039 TTTGAGGTTGTGACTGTGGCTGG + Exonic
1126980173 15:54232908-54232930 TTTGATGTTTTGAATGTGGAAGG + Intronic
1127325626 15:57892284-57892306 TCTGAAGGCCTGACTGTGGATGG - Intergenic
1127542309 15:59952841-59952863 GCAGATTTGGTGACTGGGGAGGG + Intergenic
1128138035 15:65278411-65278433 TCTGCTGTGGGGACTAAGGAAGG + Intronic
1128798747 15:70483396-70483418 TCTGGTGTGGAGACTGGTGAGGG + Intergenic
1130367990 15:83257779-83257801 TCTGACGGGGTGAGTGAGGAAGG - Exonic
1132594817 16:743919-743941 TGTGATGCTGTGACTGTGTATGG + Intronic
1133730693 16:8576315-8576337 TTTGATGGGGTGTCTTTGGAGGG - Intronic
1134385071 16:13764093-13764115 TTTGATGAGGTGAATGTGGAGGG + Intergenic
1141638505 16:85328343-85328365 TCTGAGGAGGTGGCTGGGGAAGG - Intergenic
1142275566 16:89117018-89117040 TATTACGTGGTGACTGTGGCCGG - Intronic
1142608731 17:1096533-1096555 TCTGAGGCTGTGGCTGTGGAGGG + Intronic
1145104781 17:20105857-20105879 TCTGGGGTGGTGGCTGGGGATGG + Intronic
1145187220 17:20805358-20805380 TGTGATGTGGCCAATGTGGAAGG - Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1147891402 17:43720031-43720053 ACCGAAGTGGTGGCTGTGGAGGG + Intergenic
1147961835 17:44172249-44172271 GCTAATGTGCTGACTGAGGAGGG + Exonic
1148354094 17:46963739-46963761 TCTCCAGTGGTGACTGTGGGTGG - Intronic
1150315043 17:64161962-64161984 TCTGAGGTGGTGGCCGTGTAGGG - Intronic
1150415376 17:64983938-64983960 GCTGATTTGGTGTCTGGGGAGGG - Intergenic
1150796297 17:68240098-68240120 GCTGATCTGGTGTCTGGGGAGGG + Intergenic
1152703067 17:81829041-81829063 CCTGAGGTGGTGGATGTGGAGGG + Intronic
1152930188 17:83105332-83105354 TCTGAACTGATGACAGTGGACGG + Intergenic
1154341352 18:13505030-13505052 TCTGGTGTGGGGACAATGGATGG - Intronic
1157894175 18:51448260-51448282 TCAAATGTGGCCACTGTGGAGGG - Intergenic
1157938662 18:51901431-51901453 TCTGCTGGGGAGCCTGTGGAAGG + Intergenic
1158308943 18:56138551-56138573 TTGGATGTGGTGACTAGGGAAGG + Intergenic
1158582815 18:58699828-58699850 TTGGAGGTGGGGACTGTGGATGG + Intronic
1160127120 18:76185788-76185810 TCTAATGGGGGGAGTGTGGAAGG + Intergenic
1160437606 18:78863296-78863318 TGTTATATGGTGGCTGTGGACGG - Intergenic
1162098084 19:8322687-8322709 TCAGTTGGGGTGACTGTGGCAGG - Exonic
1162523813 19:11196548-11196570 TCTGATGTGGAGTCTGAGGGTGG - Intronic
1163694171 19:18754874-18754896 TCTGTCGTGGTGAGTGTGGGTGG + Intronic
1164528737 19:29030919-29030941 GCAGATGTGGTGTCTGTGGAAGG - Intergenic
1164913044 19:32027636-32027658 TCTAGTGAGGTGAATGTGGATGG - Intergenic
1165111810 19:33507001-33507023 TGTGGTGTGGTGCATGTGGAGGG - Intronic
1165196857 19:34110911-34110933 TCTGACCTGGGGACTCTGGATGG - Intergenic
1165407272 19:35638477-35638499 TCTGAAGAGGTGTCTGTGCAGGG + Intergenic
1167557352 19:50204539-50204561 TCTGATGTGGAAACTGAGGCAGG - Intronic
1167711754 19:51115910-51115932 GCTGTTTTGGTGACTGTAGAAGG + Intergenic
925020092 2:562464-562486 TCTGATGAGGTGGCTGTAGCGGG + Intergenic
926217730 2:10915599-10915621 TCTGTGGTGGGGACTCTGGAGGG + Intergenic
928364401 2:30690302-30690324 TCCGACGTGGGGAATGTGGATGG - Intergenic
929890965 2:45918254-45918276 TCTCATGTGCTGGCTGTGGAAGG + Intronic
930189084 2:48440172-48440194 TCTGATGTGGTGTGTGTAAAGGG + Intergenic
931595316 2:63935893-63935915 TTTCATTTGGTGACTGAGGAAGG + Intronic
932433618 2:71690107-71690129 TTAGATGTGGTGCCTGTGCACGG - Intergenic
933220432 2:79681338-79681360 TCTGATGTGGTCTCACTGGAAGG - Intronic
933633089 2:84678433-84678455 TGTGATGTGGTGAGTGGTGAGGG + Intronic
934950913 2:98574853-98574875 TCTGTTCTGGTGACAGGGGATGG - Intronic
936562334 2:113551826-113551848 GCTGAGGTGGCGACTGTTGAAGG + Intergenic
938370442 2:130764743-130764765 CCTGATGTGGGGACTGTGTTGGG + Exonic
938972011 2:136441604-136441626 CCTGATCTGGTGGCTTTGGAGGG - Intergenic
940236367 2:151515162-151515184 TCTAATGTTGTGACTGGGGCAGG + Intronic
942204696 2:173608544-173608566 TCTGATGCAGTGGCTGTAGATGG + Intergenic
942321278 2:174738274-174738296 TCTGGTGTGGTGATTGCTGAGGG - Intergenic
947069707 2:226274646-226274668 TCTGATCTGGTAGCTGTGGCTGG + Intergenic
948823815 2:240564672-240564694 CCTGATGTCCTGGCTGTGGAGGG + Intronic
1169843353 20:9963378-9963400 TCTAATGAGGTGACTCTGAAAGG - Intergenic
1171060785 20:21957128-21957150 TCCTAGGTGGTGGCTGTGGAGGG + Intergenic
1172413419 20:34743246-34743268 GCTGCTGTGGTGGCTGTGGTGGG + Exonic
1172699303 20:36843141-36843163 TCTGATTTTGTGCCTGTGAAAGG + Intronic
1173993468 20:47320337-47320359 TGTGACAAGGTGACTGTGGAGGG - Intronic
1174262887 20:49309903-49309925 TCTGAGGAGGTGGCTGAGGAAGG - Intergenic
1175328590 20:58147279-58147301 TCTGAGGTGGTGTCTGTAAAAGG - Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1175972659 20:62694595-62694617 GCTGATGTGGTGGCTCTGGGGGG - Intergenic
1176154762 20:63613318-63613340 TTTCCTGTGGTCACTGTGGAAGG - Intronic
1178028334 21:28493931-28493953 TCTGATATGTGAACTGTGGATGG + Intergenic
1178399547 21:32273436-32273458 CCTAATGAGGTGACTGTGGCTGG - Intronic
1179607244 21:42524853-42524875 GCTAATGAGGTGACTGTGGCGGG + Intronic
1179818004 21:43920476-43920498 GCTAATGAGGTGACTGTGGCTGG + Intronic
1179901447 21:44396488-44396510 AGGGATGTGGAGACTGTGGAAGG + Intronic
1180038428 21:45263255-45263277 TGTGATGTGGCCACTGTGCAGGG - Intergenic
1181348455 22:22238153-22238175 TCTGAGGTGGGGACTGGGAAGGG - Intergenic
1182017836 22:27055761-27055783 TGAGATGAGGTGACTGGGGAAGG + Intergenic
1182220590 22:28755501-28755523 TCAGGAGTGGTTACTGTGGAAGG - Intronic
1182867274 22:33614651-33614673 TTGGATGGGGTGACTGTGGAAGG - Intronic
1183904030 22:41026662-41026684 GCTGATGGGGTGACCGTGAAAGG - Intergenic
1185290781 22:50026287-50026309 TCTGAGGTGGCGGCTGTGCAGGG - Intronic
950154833 3:10713677-10713699 TTTGATGGGGTGACTTTGCATGG + Intergenic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951444258 3:22759276-22759298 TCTGATGTGGTAATTGTCAAGGG - Intergenic
953569203 3:44058020-44058042 TCTGTTGTGGTGTCCCTGGAAGG + Intergenic
956719915 3:72108675-72108697 TCTGATGTGGTAGTTCTGGAAGG + Intergenic
958135196 3:89479527-89479549 ACGGAAGTGGTGGCTGTGGAAGG + Exonic
960323381 3:116265025-116265047 GCTGATGAGGTGACTTAGGAAGG - Intronic
960829849 3:121834935-121834957 TCTGAGGTGGTGGCTGGGGAGGG - Intronic
961493688 3:127275193-127275215 GCTGATGTGGGATCTGTGGAAGG + Intergenic
962069677 3:132020333-132020355 TCTGATGTGGAGGCTGAGGCTGG + Intronic
964240315 3:154585354-154585376 TCTAATGAGGTGACTCTGGGTGG + Intergenic
966478488 3:180377652-180377674 GCTGATAGGGTGACTGGGGAGGG + Intergenic
967867601 3:194203461-194203483 TCTGAGGTGGTGGTTGTCGAAGG + Intergenic
968940576 4:3635409-3635431 TCAGCTGTGTTGACTGAGGATGG - Intergenic
969149024 4:5152657-5152679 TCTCATTCGGTGACAGTGGAGGG + Intronic
969177247 4:5408024-5408046 ACAGATTTGGTGTCTGTGGAGGG - Intronic
969295386 4:6267500-6267522 TCTGATTTGGTGAGTGGGGAAGG - Intergenic
969837859 4:9858012-9858034 TCTGATTTGCTGACTCTGAAGGG - Intronic
969855409 4:9995153-9995175 TCTGCTGTGGGGTCTGTAGATGG - Intronic
971731017 4:30379850-30379872 TCTGATGTGGTTAATTTGAAAGG + Intergenic
973617812 4:52696820-52696842 TTTTATGTGGTGATTGTGAATGG - Intergenic
973690567 4:53424988-53425010 CCTAATCTAGTGACTGTGGAAGG + Intronic
975040071 4:69735521-69735543 TCTGATGTCATCACTGTGAATGG - Intronic
975949901 4:79757479-79757501 TCTGATGGGGTGGCGGAGGACGG - Intergenic
976025504 4:80683137-80683159 ACTGATGTGGTGATGGTGGTGGG + Intronic
976956637 4:90909514-90909536 ACTGATGTCTTGAATGTGGAGGG + Intronic
977652002 4:99481079-99481101 TCTTTTGTGGTGATTGTGAATGG + Intergenic
978937214 4:114392557-114392579 TCTCATGTGGGGGCTTTGGAAGG - Intergenic
979120003 4:116886346-116886368 GGTGATGTGGTGATGGTGGATGG - Intergenic
981054813 4:140349849-140349871 AGTGATGTGGCCACTGTGGAGGG - Intronic
981396130 4:144252223-144252245 TCTAATGAGGTGACTGTTGGTGG + Intergenic
981594060 4:146399242-146399264 TGTGGTGAGCTGACTGTGGAGGG + Intronic
981635133 4:146868825-146868847 TTGGAGGTGGTGCCTGTGGAAGG + Intronic
981665635 4:147222950-147222972 TCAAATGTGCTGACTCTGGATGG + Intergenic
981936118 4:150241725-150241747 GCAGATTTGGTGACTGTTGAGGG + Intronic
982613082 4:157602334-157602356 TCTGAAGAGTTGACTGTGGCAGG - Intergenic
985190217 4:187364949-187364971 TCTGTTGTGTTGACTGTGCAAGG - Intergenic
985651379 5:1109276-1109298 CCTGATGTGGTCACGGAGGAAGG + Intronic
985684069 5:1272526-1272548 TCTGATGTGGTGACTGTGGATGG - Intronic
985684076 5:1272560-1272582 TCTGATGTGGTGACTGTGGATGG - Intronic
985684082 5:1272594-1272616 TCTGATGTGGTGACTGTGGATGG - Intronic
985684089 5:1272628-1272650 TGATGTGTGGTGACTGTGGATGG - Intronic
985684096 5:1272664-1272686 TGATGTGTGGTGACTGTGGATGG - Intronic
985684103 5:1272700-1272722 TGATGTGTGGTGACTGTGGATGG - Intronic
985684110 5:1272736-1272758 TGATGTGTGGTGACTGTGGATGG - Intronic
985684117 5:1272772-1272794 TCTGATGTGGTGACTGTGGATGG - Intronic
985684124 5:1272806-1272828 TGATGTGTGGTGACTGTGGATGG - Intronic
985684131 5:1272842-1272864 TCTGATGTGGTGACTGTGGATGG - Intronic
985684138 5:1272876-1272898 TGATGTGTGGTGACTGTGGATGG - Intronic
985684145 5:1272912-1272934 TGATGTGTGGTGACTGTGGATGG - Intronic
985684163 5:1272992-1273014 TGATGTGTGGTGACTGTGGATGG - Intronic
985684170 5:1273028-1273050 TGATGTGTGGTGACTGTGGATGG - Intronic
985684177 5:1273069-1273091 TGATGTGTGGTGACTGTGGATGG - Intronic
985684184 5:1273105-1273127 TGATGTGTGGTGACTGTGGATGG - Intronic
985684191 5:1273141-1273163 TCTGATGTGGTGACTGTGGATGG - Intronic
985684198 5:1273175-1273197 TGATGTGTGGTGACTGTGGATGG - Intronic
985684205 5:1273211-1273233 TGATGTGTGGTGACTGTGGATGG - Intronic
985684212 5:1273247-1273269 TGATGTGTGGTGACTGTGGATGG - Intronic
985684219 5:1273283-1273305 TCTGATGTGGTGACTGTGGATGG - Intronic
985684226 5:1273317-1273339 TGATGTGTGGTGACTGTGGATGG - Intronic
985684233 5:1273353-1273375 TCTGATGTGGTGACTGTGGATGG - Intronic
985684240 5:1273387-1273409 TGATGTGTGGTGACTGTGGATGG - Intronic
985684247 5:1273423-1273445 TGATGTGTGGTGACTGTGGATGG - Intronic
985684254 5:1273464-1273486 TGATGTGTGGTGACTGTGGATGG - Intronic
985684265 5:1273505-1273527 TGATGTGTGGTGACTGTGGATGG - Intronic
985684272 5:1273541-1273563 TCTGATGTGGTGACTGTGGATGG - Intronic
985684279 5:1273575-1273597 TCTGATGTGGTGACTGTGGATGG - Intronic
985684286 5:1273609-1273631 TGATGTGTGGTGACTGTGGATGG - Intronic
985684297 5:1273650-1273672 TGATGTGTGGTGACTGTGGATGG - Intronic
985684304 5:1273686-1273708 TCTGATGTGGTGACTGTGGATGG - Intronic
985684311 5:1273720-1273742 TCTGATGTGGTGACTGTGGATGG - Intronic
985684318 5:1273754-1273776 TGATGTGTGGTGACTGTGGATGG - Intronic
985684326 5:1273795-1273817 TGATGTGTGGTGACTGTGGATGG - Intronic
985859590 5:2460438-2460460 TATGAAGTGGTGGCTGTAGATGG - Intergenic
987497593 5:18668279-18668301 TCTTTTGTGGTAGCTGTGGAGGG + Intergenic
989192990 5:38689470-38689492 TCTGATTTGATGACTGTGGTTGG - Intergenic
989329545 5:40240303-40240325 TCTGAAGTCATGACTGGGGAGGG - Intergenic
991524279 5:67539152-67539174 GTTGATGGGGTGATTGTGGAGGG + Intergenic
992745070 5:79811315-79811337 TCTGTGGGGGTGACTGTGGAGGG + Intergenic
993120500 5:83768546-83768568 TCTCATGTGGACACTGAGGAAGG - Intergenic
993658672 5:90603351-90603373 TCTAATGTTGCTACTGTGGAGGG + Intronic
996973045 5:129396166-129396188 TCTGATTTTGTGACAGTAGAGGG - Intergenic
997800686 5:136858027-136858049 GCTCATGCAGTGACTGTGGATGG + Intergenic
998216117 5:140239744-140239766 TCTGATGTGGGGCCTGCAGAGGG - Intronic
999886345 5:155927477-155927499 TTTGCTTGGGTGACTGTGGAAGG + Intronic
1000054740 5:157595307-157595329 TCTGAAGTGGTGAGTCTGCAAGG + Intergenic
1000693341 5:164349410-164349432 TCTGCTGTGGAGACTGTAGCTGG - Intergenic
1000706476 5:164519425-164519447 TCTGAAGTGGTGATGGTGGAGGG + Intergenic
1000722799 5:164729355-164729377 TCCAATGTGATGACTGTAGATGG + Intergenic
1001684331 5:173582220-173582242 TCTTATCTTGTGACTGTGGGAGG + Intergenic
1001894918 5:175370440-175370462 TCTGATGTGATGACTGAGCAAGG + Intergenic
1002525454 5:179813249-179813271 TCTGATAAGGTGGCTGTGGATGG - Intronic
1003723663 6:8734335-8734357 TCTTATGTTGTGACTGTATATGG + Intergenic
1003937611 6:10991858-10991880 AGTGAAATGGTGACTGTGGAAGG - Intronic
1003937899 6:10994657-10994679 GGGGAAGTGGTGACTGTGGAAGG + Intronic
1005005559 6:21283862-21283884 TCTGAAGTCTTGACTGGGGAAGG - Intergenic
1005121516 6:22394596-22394618 TCAGATGAAGTTACTGTGGAAGG + Intergenic
1006058754 6:31404214-31404236 GCTGCTGTGGGGACTGTGGGGGG + Intronic
1006071239 6:31499099-31499121 GCTGCTGTGGGGACTGTGGGGGG + Intronic
1006776644 6:36598007-36598029 TCTTCTGTGCTGACTGTTGAGGG + Intronic
1006809769 6:36812305-36812327 GCTGATGTGGAGACTGTACAGGG + Intronic
1010564217 6:77389479-77389501 TCTGATAAGGTGTCTGTGTAAGG - Intergenic
1010850560 6:80771200-80771222 TATGCTGTGCTGCCTGTGGATGG + Intergenic
1011090288 6:83590102-83590124 ACCCTTGTGGTGACTGTGGAGGG + Intronic
1012950322 6:105511559-105511581 TCTCAGGTGGTGAGTATGGAGGG - Intergenic
1013266636 6:108506120-108506142 GCAGATTTGGTGTCTGTGGAAGG - Intronic
1013595933 6:111661174-111661196 GCTAATGTGGAGACTGTGGCCGG - Exonic
1017647630 6:156553643-156553665 ACACATGTGGTGCCTGTGGAGGG - Intergenic
1017744107 6:157431503-157431525 TCTGTTTTGGAGACTGAGGATGG + Intronic
1019198216 6:170294691-170294713 TGTGTGGTGGTGACTGTGGTGGG + Intergenic
1020489003 7:8756024-8756046 CCAGATGTGATGGCTGTGGAAGG + Intergenic
1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG + Intronic
1022487135 7:30787747-30787769 TCTGCTGGGGACACTGTGGAAGG + Intronic
1022500390 7:30878887-30878909 TCTGACCTGGTGAAAGTGGATGG - Intronic
1024620317 7:51151452-51151474 TCTTATGGGGAGACTCTGGAAGG - Intronic
1024964461 7:55010356-55010378 TCTGATGAGGTGTTTGTGTAGGG + Intergenic
1026498842 7:70925761-70925783 TCTGATGTGGCCACTGTGGTAGG - Intergenic
1026861487 7:73792934-73792956 TCTGATGAGGTGACTCTTGGTGG - Intergenic
1030016669 7:105229585-105229607 TCTGTTGTGGGCACTGCGGAAGG - Intronic
1031862828 7:127001725-127001747 TCTGATATGGTTATTGTGGCAGG - Intronic
1035663003 8:1361329-1361351 TCTGAAGTAGAGACTGTGGAGGG - Intergenic
1036646649 8:10615065-10615087 TCTCATTTGGTCCCTGTGGAGGG - Intronic
1038337474 8:26656934-26656956 TCTGAACTGGTGACTTTGGTTGG - Exonic
1039778271 8:40758308-40758330 TGTGGAGTGGTGACTGTGGAGGG - Intronic
1041311218 8:56518884-56518906 TCTGCTCTGGAGCCTGTGGAGGG + Intergenic
1041667673 8:60461646-60461668 TCTGATTTAGTAGCTGTGGAGGG + Intergenic
1043143871 8:76625906-76625928 TCTAAAGGGCTGACTGTGGAAGG - Intergenic
1044423549 8:92026101-92026123 TCTGTTGTTTTGTCTGTGGATGG + Intronic
1045295406 8:100868072-100868094 TCTGCTGTGGTGGCTGCAGATGG - Intergenic
1046477356 8:114763692-114763714 TCTGCTGTGTTGGTTGTGGATGG + Intergenic
1046524070 8:115361511-115361533 TCTGGAAAGGTGACTGTGGATGG - Intergenic
1049445031 8:142626118-142626140 TGTGGTGTGGTGACAGTGGGAGG - Intergenic
1049445036 8:142626148-142626170 TGTGGGGTGGTGACTGTGGGAGG - Intergenic
1049554593 8:143275640-143275662 GCCGCCGTGGTGACTGTGGATGG + Intronic
1049890350 9:63506-63528 GCTGAGGTGGCGACTGTTGAAGG - Intergenic
1050150391 9:2614078-2614100 GATGTTGTGGTGACTGTGGCAGG - Intergenic
1051790249 9:20794004-20794026 TTTGAAGGGCTGACTGTGGAAGG - Intronic
1053144701 9:35704511-35704533 TGTCACATGGTGACTGTGGAAGG + Intronic
1053731811 9:41064687-41064709 GCTGAGGTGGCGACTGTGGAAGG - Intergenic
1054696645 9:68367029-68367051 GCTGAGGTGGCGACTGTTGAAGG + Intronic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059044939 9:110856107-110856129 GCTAATGTGGTGACTCTTGATGG - Intergenic
1060269076 9:122128451-122128473 TGTGGAGTGGGGACTGTGGAGGG - Intergenic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1062298738 9:135851364-135851386 GCTGCTTAGGTGACTGTGGAGGG - Intronic
1062544712 9:137056221-137056243 TCTGATGTGGAGACTGAGGCAGG - Intergenic
1186010721 X:5129296-5129318 TCTGATGTGATGAATGTCAAAGG + Intergenic
1187953789 X:24495842-24495864 GCTAATGTGGTGACTTAGGACGG - Intronic
1188373859 X:29403431-29403453 TCTGATGTAGGGACTGGGGCAGG - Intronic
1188535278 X:31190229-31190251 TCTGAAGAGGAGACTGTAGAGGG + Intronic
1189239803 X:39516440-39516462 TCTGATTTGTTGACTGGGGGAGG - Intergenic
1190050434 X:47145270-47145292 TTTGAGCTGGTGACTGTGGCCGG + Exonic
1193415969 X:81224349-81224371 TCTTACGTGGTGACTGGGGTTGG - Intronic
1193964518 X:87968656-87968678 TATGATGTGGTGTGTGTGCAGGG + Intergenic
1198089142 X:133310580-133310602 TCTGCTCTGGTGAGAGTGGAAGG - Intronic
1199034089 X:143031385-143031407 TCTGAGGTGGTGATGGTGGTAGG + Intronic
1199848206 X:151706827-151706849 CTTAATGGGGTGACTGTGGAGGG + Intergenic
1201337678 Y:12897828-12897850 TATGATGTGGTGAGGGTGGAAGG + Intergenic
1202039448 Y:20667029-20667051 TCTGAGGTGGTGATGGTGGTGGG - Intergenic